Incidental Mutation 'R6288:Gucy2g'
ID509252
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Nameguanylate cyclase 2g
SynonymsGC-G, 2410077I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location55198297-55241236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55227513 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 476 (T476A)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
Predicted Effect probably benign
Transcript: ENSMUST00000069183
AA Change: T476A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: T476A

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55233103 missense probably benign 0.01
IGL01954:Gucy2g APN 19 55198691 missense probably benign 0.01
IGL01969:Gucy2g APN 19 55227438 missense probably benign 0.00
IGL02164:Gucy2g APN 19 55238023 missense probably benign
IGL02534:Gucy2g APN 19 55241068 missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55206177 missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55210354 missense probably benign 0.10
IGL03187:Gucy2g APN 19 55231052 missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55233080 missense possibly damaging 0.95
PIT4366001:Gucy2g UTSW 19 55237782 missense probably null 0.51
R0040:Gucy2g UTSW 19 55217302 missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55241166 missense probably benign
R0318:Gucy2g UTSW 19 55237798 missense probably benign 0.00
R0576:Gucy2g UTSW 19 55198770 missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55203087 missense probably benign 0.00
R0962:Gucy2g UTSW 19 55210284 nonsense probably null
R1348:Gucy2g UTSW 19 55222906 missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55215036 splice site probably benign
R1693:Gucy2g UTSW 19 55222926 missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55199541 missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55210309 missense probably benign 0.34
R1830:Gucy2g UTSW 19 55222930 missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55210237 missense probably benign 0.20
R1927:Gucy2g UTSW 19 55237759 missense probably benign 0.02
R1969:Gucy2g UTSW 19 55222896 missense possibly damaging 0.90
R1969:Gucy2g UTSW 19 55233053 missense probably benign 0.42
R2071:Gucy2g UTSW 19 55222340 missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55240947 missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55210276 missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55229769 missense possibly damaging 0.96
R4405:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4407:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4614:Gucy2g UTSW 19 55202147 nonsense probably null
R4671:Gucy2g UTSW 19 55238068 missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55206256 missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55226053 missense probably benign
R4969:Gucy2g UTSW 19 55226013 missense probably benign
R5050:Gucy2g UTSW 19 55240935 missense probably benign 0.05
R5059:Gucy2g UTSW 19 55226071 missense probably benign 0.00
R5070:Gucy2g UTSW 19 55229787 missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55198701 missense probably benign 0.00
R5531:Gucy2g UTSW 19 55241140 missense probably benign 0.24
R5536:Gucy2g UTSW 19 55237927 missense probably benign 0.05
R5679:Gucy2g UTSW 19 55231079 missense possibly damaging 0.87
R5715:Gucy2g UTSW 19 55233155 missense possibly damaging 0.93
R5941:Gucy2g UTSW 19 55215131 missense probably damaging 1.00
R6250:Gucy2g UTSW 19 55217424 missense probably damaging 0.99
R6378:Gucy2g UTSW 19 55240945 missense probably benign 0.00
R6605:Gucy2g UTSW 19 55241028 missense probably damaging 1.00
R7020:Gucy2g UTSW 19 55233050 missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55210332 missense probably benign 0.01
R7078:Gucy2g UTSW 19 55241151 missense probably damaging 1.00
R7402:Gucy2g UTSW 19 55206293 missense probably damaging 1.00
R7539:Gucy2g UTSW 19 55203154 missense probably damaging 0.99
R7561:Gucy2g UTSW 19 55206340 missense probably benign 0.38
R7583:Gucy2g UTSW 19 55235615 missense probably damaging 1.00
R7804:Gucy2g UTSW 19 55228152 missense probably benign 0.02
R7880:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
R8442:Gucy2g UTSW 19 55217401 missense probably benign 0.00
R8559:Gucy2g UTSW 19 55210354 missense probably benign 0.10
Z1177:Gucy2g UTSW 19 55210377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCCTTGTCAAGTCACGAG -3'
(R):5'- CTAGAGTTGTCATGGTAGCGAG -3'

Sequencing Primer
(F):5'- AAAGTGTGTGTGGCCTCAC -3'
(R):5'- TAGGCCACCATATCTGGA -3'
Posted On2018-04-02