Incidental Mutation 'R6302:Nsd2'
ID509267
Institutional Source Beutler Lab
Gene Symbol Nsd2
Ensembl Gene ENSMUSG00000057406
Gene Namenuclear receptor binding SET domain protein 2
Synonyms5830445G22Rik, Whsc1, Whsc1l, C130020C13Rik, 9430010A17Rik, D030027O06Rik, D930023B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R6302 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location33820725-33897975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33867577 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 560 (R560G)
Ref Sequence ENSEMBL: ENSMUSP00000075210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058096] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000114397] [ENSMUST00000114399] [ENSMUST00000137191] [ENSMUST00000139845]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058096
AA Change: R559G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058940
Gene: ENSMUSG00000057406
AA Change: R559G

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 629 643 N/A INTRINSIC
PHD 669 711 1.36e-6 SMART
RING 670 710 1.5e1 SMART
PHD 716 763 6.81e-1 SMART
RING 717 762 5.25e-2 SMART
PHD 833 873 2.35e-10 SMART
PWWP 878 940 2.67e-23 SMART
AWS 1011 1062 3.74e-27 SMART
SET 1063 1186 4.48e-43 SMART
PostSET 1187 1203 7.56e-4 SMART
low complexity region 1215 1236 N/A INTRINSIC
PHD 1241 1284 1.98e-8 SMART
low complexity region 1347 1360 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066854
AA Change: R560G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406
AA Change: R560G

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075812
AA Change: R560G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406
AA Change: R560G

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114397
AA Change: R559G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110039
Gene: ENSMUSG00000057406
AA Change: R559G

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.7e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114399
AA Change: R559G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110041
Gene: ENSMUSG00000057406
AA Change: R559G

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137191
AA Change: R559G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406
AA Change: R559G

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139845
AA Change: R559G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406
AA Change: R559G

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141416
AA Change: E501G
SMART Domains Protein: ENSMUSP00000117233
Gene: ENSMUSG00000057406
AA Change: E501G

DomainStartEndE-ValueType
Pfam:PWWP 202 314 1.1e-25 PFAM
low complexity region 379 390 N/A INTRINSIC
HMG 434 504 4.7e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142080
AA Change: R78G
SMART Domains Protein: ENSMUSP00000115251
Gene: ENSMUSG00000057406
AA Change: R78G

DomainStartEndE-ValueType
Blast:SET 2 148 7e-47 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains four domains present in other developmental proteins: a PWWP domain, an HMG box, a SET domain, and a PHD-type zinc finger. It is expressed ubiquitously in early development. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene maps to the 165 kb WHS critical region and has also been involved in the chromosomal translocation t(4;14)(p16.3;q32.3) in multiple myelomas. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Some transcript variants are nonsense-mediated mRNA (NMD) decay candidates, hence not represented as reference sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced fetal size, failed sternum ossification, cleft palate, atrial and ventricular septal defects, stunted growth and postnatal death. Some heterozygotes show severe growth defects, malocclusion, delayed sternum ossification and hypoplasia of the septum secundum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T G 9: 107,929,573 V365G probably benign Het
Adgrg6 T A 10: 14,441,483 D531V probably benign Het
Ankrd11 A G 8: 122,889,989 S2354P probably benign Het
Ano9 A T 7: 141,104,308 W514R probably damaging Het
Arfgef3 A T 10: 18,652,841 V266E probably damaging Het
Bahcc1 T C 11: 120,276,808 I1345T probably damaging Het
BC067074 A G 13: 113,368,112 D1925G probably damaging Het
Bpifb4 G A 2: 153,959,667 M355I probably benign Het
Catsperb T C 12: 101,588,143 S699P possibly damaging Het
Cdh23 T G 10: 60,305,093 I3161L possibly damaging Het
Chd3 T C 11: 69,353,778 T1257A probably damaging Het
Cnnm4 C T 1: 36,499,955 T638I probably benign Het
Cyp26c1 A G 19: 37,686,488 T86A probably damaging Het
Cyp3a63-ps A G 5: 145,628,037 noncoding transcript Het
Dnah14 T A 1: 181,601,206 I259N possibly damaging Het
Dnah17 T C 11: 118,129,155 D22G probably benign Het
Epn2 T G 11: 61,546,486 T87P probably damaging Het
Fbxl18 A G 5: 142,888,823 L81P probably damaging Het
Gas1 A T 13: 60,176,156 D221E probably damaging Het
Gm436 G T 4: 144,670,190 S324* probably null Het
Gm8356 T C 14: 6,535,128 Y130C probably damaging Het
Gpr151 T G 18: 42,579,394 K73T probably damaging Het
Helq A C 5: 100,798,439 V12G probably damaging Het
Inpp4b A G 8: 81,768,177 T74A probably benign Het
Kirrel3 G A 9: 35,007,749 V234I probably damaging Het
Kxd1 T A 8: 70,520,063 probably null Het
Lif T C 11: 4,268,924 Y68H probably damaging Het
Map6 A G 7: 99,336,107 Q406R probably damaging Het
Mcoln3 A T 3: 146,124,772 M86L probably benign Het
Mei1 T A 15: 82,103,238 Y834* probably null Het
Mroh1 T C 15: 76,436,119 probably null Het
Myo15b T C 11: 115,886,239 I2319T possibly damaging Het
Myo7b T G 18: 31,994,386 D621A probably damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nek7 T C 1: 138,498,613 D254G probably damaging Het
Olfr325 T C 11: 58,581,638 F265L probably benign Het
Olfr686 A T 7: 105,203,719 L208H probably damaging Het
Pbx1 T A 1: 168,191,341 T312S probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pitrm1 A G 13: 6,560,061 S390G probably damaging Het
Plcxd3 C T 15: 4,516,757 T81M probably damaging Het
Pmf1 C T 3: 88,399,710 probably null Het
Rabep1 T C 11: 70,935,121 V739A probably damaging Het
Rex2 A G 4: 147,057,994 D313G possibly damaging Het
Rpia C T 6: 70,773,501 V216I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sec13 T A 6: 113,735,206 H56L probably damaging Het
Sec16a A T 2: 26,425,805 V1733D probably damaging Het
Sim2 G A 16: 94,097,230 A108T probably damaging Het
Slc27a5 T C 7: 12,988,552 D665G probably damaging Het
Slc38a6 T A 12: 73,337,075 V180E probably damaging Het
Smarcad1 T G 6: 65,075,138 N38K possibly damaging Het
Spem2 T C 11: 69,818,265 T45A possibly damaging Het
Svil T C 18: 5,057,432 S714P probably benign Het
Taar7b T A 10: 24,000,260 S108T possibly damaging Het
Tbl3 T C 17: 24,704,671 K256E probably benign Het
Tcam1 T G 11: 106,286,450 C423G probably damaging Het
Trpm4 A T 7: 45,327,719 probably null Het
Ttyh2 T C 11: 114,701,836 C231R probably damaging Het
Ugt3a2 C T 15: 9,365,311 P337S probably damaging Het
Vmn2r83 A C 10: 79,469,003 T16P possibly damaging Het
Vps52 T C 17: 33,963,215 F589S probably damaging Het
Xkr4 T C 1: 3,216,738 T410A probably damaging Het
Xkr9 A G 1: 13,672,502 T4A probably damaging Het
Yars2 T C 16: 16,304,574 L268P probably damaging Het
Zbtb41 C A 1: 139,429,289 N427K possibly damaging Het
Zeb2 T C 2: 44,997,759 T414A probably benign Het
Other mutations in Nsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Nsd2 APN 5 33855733 missense probably damaging 1.00
IGL00420:Nsd2 APN 5 33883003 missense possibly damaging 0.82
IGL01343:Nsd2 APN 5 33843578 missense probably damaging 1.00
IGL01403:Nsd2 APN 5 33885378 splice site probably benign
IGL01446:Nsd2 APN 5 33861186 splice site probably benign
IGL01571:Nsd2 APN 5 33864687 missense probably benign 0.32
IGL01862:Nsd2 APN 5 33843736 missense probably null 1.00
IGL02040:Nsd2 APN 5 33867571 splice site probably benign
IGL02528:Nsd2 APN 5 33879051 unclassified probably benign
IGL02553:Nsd2 APN 5 33846198 missense probably damaging 1.00
IGL02799:Nsd2 APN 5 33864788 splice site probably benign
IGL02932:Nsd2 APN 5 33880128 missense probably damaging 1.00
Tennis UTSW 5 33843513 missense probably damaging 1.00
R0136:Nsd2 UTSW 5 33855536 missense possibly damaging 0.89
R0372:Nsd2 UTSW 5 33891551 missense probably damaging 0.98
R0521:Nsd2 UTSW 5 33843338 missense probably damaging 1.00
R0548:Nsd2 UTSW 5 33893538 missense probably damaging 1.00
R0726:Nsd2 UTSW 5 33861028 unclassified probably benign
R1018:Nsd2 UTSW 5 33843241 missense probably damaging 1.00
R1638:Nsd2 UTSW 5 33882120 missense possibly damaging 0.87
R1649:Nsd2 UTSW 5 33854640 missense probably damaging 0.98
R1675:Nsd2 UTSW 5 33861149 missense probably benign 0.04
R1900:Nsd2 UTSW 5 33846169 missense probably benign
R2001:Nsd2 UTSW 5 33843402 missense probably damaging 1.00
R2167:Nsd2 UTSW 5 33882919 missense probably damaging 1.00
R2261:Nsd2 UTSW 5 33885527 missense probably damaging 1.00
R2966:Nsd2 UTSW 5 33846122 missense probably benign 0.01
R3931:Nsd2 UTSW 5 33846117 missense probably benign 0.01
R4429:Nsd2 UTSW 5 33843202 missense probably damaging 1.00
R4596:Nsd2 UTSW 5 33882918 missense probably damaging 1.00
R4958:Nsd2 UTSW 5 33892022 missense probably damaging 1.00
R5346:Nsd2 UTSW 5 33879136 missense possibly damaging 0.94
R5957:Nsd2 UTSW 5 33855603 missense probably damaging 1.00
R6054:Nsd2 UTSW 5 33882161 missense probably damaging 1.00
R6124:Nsd2 UTSW 5 33843266 missense probably benign 0.08
R6390:Nsd2 UTSW 5 33881181 missense probably damaging 1.00
R6496:Nsd2 UTSW 5 33843513 missense probably damaging 1.00
R6828:Nsd2 UTSW 5 33893568 missense probably damaging 0.98
R6925:Nsd2 UTSW 5 33879110 missense probably damaging 1.00
R7148:Nsd2 UTSW 5 33885511 missense possibly damaging 0.57
R7311:Nsd2 UTSW 5 33892036 missense probably damaging 1.00
R7337:Nsd2 UTSW 5 33885472 missense probably damaging 1.00
R7466:Nsd2 UTSW 5 33882147 nonsense probably null
R7567:Nsd2 UTSW 5 33846226 missense probably damaging 0.99
R7704:Nsd2 UTSW 5 33871467 makesense probably null
R7822:Nsd2 UTSW 5 33843594 missense probably damaging 0.97
X0020:Nsd2 UTSW 5 33854757 missense probably damaging 1.00
Z1088:Nsd2 UTSW 5 33855738 critical splice donor site probably null
Z1177:Nsd2 UTSW 5 33855520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTGGTCCTGTTGAGTG -3'
(R):5'- AGCTTAATTGTTGACTCTCCCGAG -3'

Sequencing Primer
(F):5'- AGTGTGAGGAGTACTTTTCCAAAG -3'
(R):5'- TCTCAGGTGCCCACACTAGAG -3'
Posted On2018-04-02