Mutagenetix > Incidental Mutation

Incidental Mutation 'R6302:Trpm4'

509276

Institutional Source

Beutler Lab

Gene Symbol

Trpm4

Ensembl Gene

ENSMUSG00000038260

Gene Name

transient receptor potential cation channel, subfamily M, member 4

Synonyms

LTRPC4, TRPM4B, 1110030C19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R6302 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45302632-45333780 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 45327719 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000040367 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000210541] [ENSMUST00000211431] [ENSMUST00000211743]

AlphaFold

Q7TN37

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000026901

Predicted Effect

probably null
Transcript: ENSMUST00000042194

SMART Domains

Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

Domain	Start	End	E-Value	Type
low complexity region	118	131	N/A	INTRINSIC
SCOP:d1awcb_	378	465	2e-3	SMART
low complexity region	600	612	N/A	INTRINSIC
low complexity region	637	645	N/A	INTRINSIC
transmembrane domain	688	710	N/A	INTRINSIC
Pfam:Ion_trans	781	1051	1.8e-13	PFAM
low complexity region	1089	1096	N/A	INTRINSIC
low complexity region	1191	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000210541

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211411

Predicted Effect

probably benign
Transcript: ENSMUST00000211431

Predicted Effect

probably benign
Transcript: ENSMUST00000211743

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl11	T	G	9: 107,929,573	V365G	probably benign	Het
Adgrg6	T	A	10: 14,441,483	D531V	probably benign	Het
Ankrd11	A	G	8: 122,889,989	S2354P	probably benign	Het
Ano9	A	T	7: 141,104,308	W514R	probably damaging	Het
Arfgef3	A	T	10: 18,652,841	V266E	probably damaging	Het
Bahcc1	T	C	11: 120,276,808	I1345T	probably damaging	Het
BC067074	A	G	13: 113,368,112	D1925G	probably damaging	Het
Bpifb4	G	A	2: 153,959,667	M355I	probably benign	Het
Catsperb	T	C	12: 101,588,143	S699P	possibly damaging	Het
Cdh23	T	G	10: 60,305,093	I3161L	possibly damaging	Het
Chd3	T	C	11: 69,353,778	T1257A	probably damaging	Het
Cnnm4	C	T	1: 36,499,955	T638I	probably benign	Het
Cyp26c1	A	G	19: 37,686,488	T86A	probably damaging	Het
Cyp3a63-ps	A	G	5: 145,628,037		noncoding transcript	Het
Dnah14	T	A	1: 181,601,206	I259N	possibly damaging	Het
Dnah17	T	C	11: 118,129,155	D22G	probably benign	Het
Epn2	T	G	11: 61,546,486	T87P	probably damaging	Het
Fbxl18	A	G	5: 142,888,823	L81P	probably damaging	Het
Gas1	A	T	13: 60,176,156	D221E	probably damaging	Het
Gm436	G	T	4: 144,670,190	S324*	probably null	Het
Gm8356	T	C	14: 6,535,128	Y130C	probably damaging	Het
Gpr151	T	G	18: 42,579,394	K73T	probably damaging	Het
Helq	A	C	5: 100,798,439	V12G	probably damaging	Het
Inpp4b	A	G	8: 81,768,177	T74A	probably benign	Het
Kirrel3	G	A	9: 35,007,749	V234I	probably damaging	Het
Kxd1	T	A	8: 70,520,063		probably null	Het
Lif	T	C	11: 4,268,924	Y68H	probably damaging	Het
Map6	A	G	7: 99,336,107	Q406R	probably damaging	Het
Mcoln3	A	T	3: 146,124,772	M86L	probably benign	Het
Mei1	T	A	15: 82,103,238	Y834*	probably null	Het
Mroh1	T	C	15: 76,436,119		probably null	Het
Myo15b	T	C	11: 115,886,239	I2319T	possibly damaging	Het
Myo7b	T	G	18: 31,994,386	D621A	probably damaging	Het
Naip5	C	T	13: 100,223,166	A521T	possibly damaging	Het
Nek7	T	C	1: 138,498,613	D254G	probably damaging	Het
Nsd2	A	G	5: 33,867,577	R560G	possibly damaging	Het
Olfr325	T	C	11: 58,581,638	F265L	probably benign	Het
Olfr686	A	T	7: 105,203,719	L208H	probably damaging	Het
Pbx1	T	A	1: 168,191,341	T312S	probably benign	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Pitrm1	A	G	13: 6,560,061	S390G	probably damaging	Het
Plcxd3	C	T	15: 4,516,757	T81M	probably damaging	Het
Pmf1	C	T	3: 88,399,710		probably null	Het
Rabep1	T	C	11: 70,935,121	V739A	probably damaging	Het
Rex2	A	G	4: 147,057,994	D313G	possibly damaging	Het
Rpia	C	T	6: 70,773,501	V216I	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Sec13	T	A	6: 113,735,206	H56L	probably damaging	Het
Sec16a	A	T	2: 26,425,805	V1733D	probably damaging	Het
Sim2	G	A	16: 94,097,230	A108T	probably damaging	Het
Slc27a5	T	C	7: 12,988,552	D665G	probably damaging	Het
Slc38a6	T	A	12: 73,337,075	V180E	probably damaging	Het
Smarcad1	T	G	6: 65,075,138	N38K	possibly damaging	Het
Spem2	T	C	11: 69,818,265	T45A	possibly damaging	Het
Svil	T	C	18: 5,057,432	S714P	probably benign	Het
Taar7b	T	A	10: 24,000,260	S108T	possibly damaging	Het
Tbl3	T	C	17: 24,704,671	K256E	probably benign	Het
Tcam1	T	G	11: 106,286,450	C423G	probably damaging	Het
Ttyh2	T	C	11: 114,701,836	C231R	probably damaging	Het
Ugt3a2	C	T	15: 9,365,311	P337S	probably damaging	Het
Vmn2r83	A	C	10: 79,469,003	T16P	possibly damaging	Het
Vps52	T	C	17: 33,963,215	F589S	probably damaging	Het
Xkr4	T	C	1: 3,216,738	T410A	probably damaging	Het
Xkr9	A	G	1: 13,672,502	T4A	probably damaging	Het
Yars2	T	C	16: 16,304,574	L268P	probably damaging	Het
Zbtb41	C	A	1: 139,429,289	N427K	possibly damaging	Het
Zeb2	T	C	2: 44,997,759	T414A	probably benign	Het

Other mutations in Trpm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Trpm4	APN	7	45318349	missense	probably benign
IGL01327:Trpm4	APN	7	45315073	missense	probably damaging	1.00
IGL02069:Trpm4	APN	7	45319294	missense	probably damaging	1.00
IGL02124:Trpm4	APN	7	45310523	missense	probably damaging	1.00
IGL02141:Trpm4	APN	7	45318179	splice site	probably null
IGL02333:Trpm4	APN	7	45322115	missense	possibly damaging	0.85
IGL02338:Trpm4	APN	7	45326998	missense	probably damaging	1.00
IGL02741:Trpm4	APN	7	45318488	missense	possibly damaging	0.82
R0041:Trpm4	UTSW	7	45304946	critical splice donor site	probably null
R0106:Trpm4	UTSW	7	45319240	critical splice donor site	probably null
R0270:Trpm4	UTSW	7	45319253	missense	possibly damaging	0.45
R0279:Trpm4	UTSW	7	45322048	missense	probably damaging	0.99
R0309:Trpm4	UTSW	7	45308706	missense	probably damaging	1.00
R0539:Trpm4	UTSW	7	45305472	missense	probably damaging	0.99
R0969:Trpm4	UTSW	7	45327907	intron	probably benign
R1454:Trpm4	UTSW	7	45317056	missense	probably damaging	0.99
R1512:Trpm4	UTSW	7	45315044	missense	probably benign	0.07
R1579:Trpm4	UTSW	7	45308597	missense	probably damaging	1.00
R1768:Trpm4	UTSW	7	45308612	missense	probably damaging	0.97
R2847:Trpm4	UTSW	7	45310598	missense	probably damaging	1.00
R3883:Trpm4	UTSW	7	45321998	critical splice donor site	probably null
R3884:Trpm4	UTSW	7	45321998	critical splice donor site	probably null
R4895:Trpm4	UTSW	7	45318058	missense	probably damaging	0.98
R5056:Trpm4	UTSW	7	45308630	missense	probably damaging	0.98
R5060:Trpm4	UTSW	7	45321834	missense	probably damaging	1.00
R5069:Trpm4	UTSW	7	45310469	missense	probably damaging	1.00
R5560:Trpm4	UTSW	7	45310332	missense	probably damaging	1.00
R5783:Trpm4	UTSW	7	45310389	missense	probably benign
R5874:Trpm4	UTSW	7	45327749	missense	probably damaging	1.00
R6176:Trpm4	UTSW	7	45326676	missense	probably damaging	1.00
R6431:Trpm4	UTSW	7	45326568	missense	possibly damaging	0.79
R6762:Trpm4	UTSW	7	45304816	utr 3 prime	probably benign
R6827:Trpm4	UTSW	7	45318628	missense	possibly damaging	0.89
R6845:Trpm4	UTSW	7	45322329	missense	possibly damaging	0.88
R6950:Trpm4	UTSW	7	45319280	missense	probably damaging	0.97
R7126:Trpm4	UTSW	7	45310709	splice site	probably null
R7159:Trpm4	UTSW	7	45327268	splice site	probably null
R7167:Trpm4	UTSW	7	45327719	critical splice donor site	probably null
R7386:Trpm4	UTSW	7	45314640	missense	possibly damaging	0.47
R7516:Trpm4	UTSW	7	45305020	missense	probably damaging	1.00
R7655:Trpm4	UTSW	7	45321809	missense	probably benign	0.00
R7656:Trpm4	UTSW	7	45321809	missense	probably benign	0.00
R7743:Trpm4	UTSW	7	45308338	missense	probably benign	0.14
R7943:Trpm4	UTSW	7	45308681	missense	probably damaging	1.00
R7955:Trpm4	UTSW	7	45319259	missense	probably damaging	1.00
R8060:Trpm4	UTSW	7	45305451	missense	probably damaging	1.00
R8119:Trpm4	UTSW	7	45327128	missense	probably damaging	1.00
R8225:Trpm4	UTSW	7	45305334	missense	probably benign
R8395:Trpm4	UTSW	7	45309210	missense	probably benign	0.00
R8509:Trpm4	UTSW	7	45322361	missense	probably damaging	1.00
R8897:Trpm4	UTSW	7	45310631	missense	probably benign	0.02
R9577:Trpm4	UTSW	7	45305008	nonsense	probably null
R9674:Trpm4	UTSW	7	45333387	missense	possibly damaging	0.87
R9731:Trpm4	UTSW	7	45308630	missense	probably damaging	0.98
X0018:Trpm4	UTSW	7	45314634	missense	possibly damaging	0.61
X0022:Trpm4	UTSW	7	45310511	missense	probably damaging	1.00
Z1177:Trpm4	UTSW	7	45326718	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GACAAACGCAGATAGTGGCC -3'
(R):5'- GGGTTCATACTCTACCCTCATG -3'

Sequencing Primer
(F):5'- ACGCAGATAGTGGCCTAGAG -3'
(R):5'- TACCCTCATGCCCCCAGAGG -3'

Posted On

2018-04-02