Incidental Mutation 'R6302:Trpm4'
ID 509276
Institutional Source Beutler Lab
Gene Symbol Trpm4
Ensembl Gene ENSMUSG00000038260
Gene Name transient receptor potential cation channel, subfamily M, member 4
Synonyms LTRPC4, TRPM4B, 1110030C19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock # R6302 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45302632-45333780 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 45327719 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000210541] [ENSMUST00000211431] [ENSMUST00000211743]
AlphaFold Q7TN37
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026901
Predicted Effect probably null
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211411
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably benign
Transcript: ENSMUST00000211743
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T G 9: 107,929,573 V365G probably benign Het
Adgrg6 T A 10: 14,441,483 D531V probably benign Het
Ankrd11 A G 8: 122,889,989 S2354P probably benign Het
Ano9 A T 7: 141,104,308 W514R probably damaging Het
Arfgef3 A T 10: 18,652,841 V266E probably damaging Het
Bahcc1 T C 11: 120,276,808 I1345T probably damaging Het
BC067074 A G 13: 113,368,112 D1925G probably damaging Het
Bpifb4 G A 2: 153,959,667 M355I probably benign Het
Catsperb T C 12: 101,588,143 S699P possibly damaging Het
Cdh23 T G 10: 60,305,093 I3161L possibly damaging Het
Chd3 T C 11: 69,353,778 T1257A probably damaging Het
Cnnm4 C T 1: 36,499,955 T638I probably benign Het
Cyp26c1 A G 19: 37,686,488 T86A probably damaging Het
Cyp3a63-ps A G 5: 145,628,037 noncoding transcript Het
Dnah14 T A 1: 181,601,206 I259N possibly damaging Het
Dnah17 T C 11: 118,129,155 D22G probably benign Het
Epn2 T G 11: 61,546,486 T87P probably damaging Het
Fbxl18 A G 5: 142,888,823 L81P probably damaging Het
Gas1 A T 13: 60,176,156 D221E probably damaging Het
Gm436 G T 4: 144,670,190 S324* probably null Het
Gm8356 T C 14: 6,535,128 Y130C probably damaging Het
Gpr151 T G 18: 42,579,394 K73T probably damaging Het
Helq A C 5: 100,798,439 V12G probably damaging Het
Inpp4b A G 8: 81,768,177 T74A probably benign Het
Kirrel3 G A 9: 35,007,749 V234I probably damaging Het
Kxd1 T A 8: 70,520,063 probably null Het
Lif T C 11: 4,268,924 Y68H probably damaging Het
Map6 A G 7: 99,336,107 Q406R probably damaging Het
Mcoln3 A T 3: 146,124,772 M86L probably benign Het
Mei1 T A 15: 82,103,238 Y834* probably null Het
Mroh1 T C 15: 76,436,119 probably null Het
Myo15b T C 11: 115,886,239 I2319T possibly damaging Het
Myo7b T G 18: 31,994,386 D621A probably damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nek7 T C 1: 138,498,613 D254G probably damaging Het
Nsd2 A G 5: 33,867,577 R560G possibly damaging Het
Olfr325 T C 11: 58,581,638 F265L probably benign Het
Olfr686 A T 7: 105,203,719 L208H probably damaging Het
Pbx1 T A 1: 168,191,341 T312S probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pitrm1 A G 13: 6,560,061 S390G probably damaging Het
Plcxd3 C T 15: 4,516,757 T81M probably damaging Het
Pmf1 C T 3: 88,399,710 probably null Het
Rabep1 T C 11: 70,935,121 V739A probably damaging Het
Rex2 A G 4: 147,057,994 D313G possibly damaging Het
Rpia C T 6: 70,773,501 V216I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sec13 T A 6: 113,735,206 H56L probably damaging Het
Sec16a A T 2: 26,425,805 V1733D probably damaging Het
Sim2 G A 16: 94,097,230 A108T probably damaging Het
Slc27a5 T C 7: 12,988,552 D665G probably damaging Het
Slc38a6 T A 12: 73,337,075 V180E probably damaging Het
Smarcad1 T G 6: 65,075,138 N38K possibly damaging Het
Spem2 T C 11: 69,818,265 T45A possibly damaging Het
Svil T C 18: 5,057,432 S714P probably benign Het
Taar7b T A 10: 24,000,260 S108T possibly damaging Het
Tbl3 T C 17: 24,704,671 K256E probably benign Het
Tcam1 T G 11: 106,286,450 C423G probably damaging Het
Ttyh2 T C 11: 114,701,836 C231R probably damaging Het
Ugt3a2 C T 15: 9,365,311 P337S probably damaging Het
Vmn2r83 A C 10: 79,469,003 T16P possibly damaging Het
Vps52 T C 17: 33,963,215 F589S probably damaging Het
Xkr4 T C 1: 3,216,738 T410A probably damaging Het
Xkr9 A G 1: 13,672,502 T4A probably damaging Het
Yars2 T C 16: 16,304,574 L268P probably damaging Het
Zbtb41 C A 1: 139,429,289 N427K possibly damaging Het
Zeb2 T C 2: 44,997,759 T414A probably benign Het
Other mutations in Trpm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Trpm4 APN 7 45318349 missense probably benign
IGL01327:Trpm4 APN 7 45315073 missense probably damaging 1.00
IGL02069:Trpm4 APN 7 45319294 missense probably damaging 1.00
IGL02124:Trpm4 APN 7 45310523 missense probably damaging 1.00
IGL02141:Trpm4 APN 7 45318179 splice site probably null
IGL02333:Trpm4 APN 7 45322115 missense possibly damaging 0.85
IGL02338:Trpm4 APN 7 45326998 missense probably damaging 1.00
IGL02741:Trpm4 APN 7 45318488 missense possibly damaging 0.82
R0041:Trpm4 UTSW 7 45304946 critical splice donor site probably null
R0106:Trpm4 UTSW 7 45319240 critical splice donor site probably null
R0270:Trpm4 UTSW 7 45319253 missense possibly damaging 0.45
R0279:Trpm4 UTSW 7 45322048 missense probably damaging 0.99
R0309:Trpm4 UTSW 7 45308706 missense probably damaging 1.00
R0539:Trpm4 UTSW 7 45305472 missense probably damaging 0.99
R0969:Trpm4 UTSW 7 45327907 intron probably benign
R1454:Trpm4 UTSW 7 45317056 missense probably damaging 0.99
R1512:Trpm4 UTSW 7 45315044 missense probably benign 0.07
R1579:Trpm4 UTSW 7 45308597 missense probably damaging 1.00
R1768:Trpm4 UTSW 7 45308612 missense probably damaging 0.97
R2847:Trpm4 UTSW 7 45310598 missense probably damaging 1.00
R3883:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R3884:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R4895:Trpm4 UTSW 7 45318058 missense probably damaging 0.98
R5056:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
R5060:Trpm4 UTSW 7 45321834 missense probably damaging 1.00
R5069:Trpm4 UTSW 7 45310469 missense probably damaging 1.00
R5560:Trpm4 UTSW 7 45310332 missense probably damaging 1.00
R5783:Trpm4 UTSW 7 45310389 missense probably benign
R5874:Trpm4 UTSW 7 45327749 missense probably damaging 1.00
R6176:Trpm4 UTSW 7 45326676 missense probably damaging 1.00
R6431:Trpm4 UTSW 7 45326568 missense possibly damaging 0.79
R6762:Trpm4 UTSW 7 45304816 utr 3 prime probably benign
R6827:Trpm4 UTSW 7 45318628 missense possibly damaging 0.89
R6845:Trpm4 UTSW 7 45322329 missense possibly damaging 0.88
R6950:Trpm4 UTSW 7 45319280 missense probably damaging 0.97
R7126:Trpm4 UTSW 7 45310709 splice site probably null
R7159:Trpm4 UTSW 7 45327268 splice site probably null
R7167:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R7386:Trpm4 UTSW 7 45314640 missense possibly damaging 0.47
R7516:Trpm4 UTSW 7 45305020 missense probably damaging 1.00
R7655:Trpm4 UTSW 7 45321809 missense probably benign 0.00
R7656:Trpm4 UTSW 7 45321809 missense probably benign 0.00
R7743:Trpm4 UTSW 7 45308338 missense probably benign 0.14
R7943:Trpm4 UTSW 7 45308681 missense probably damaging 1.00
R7955:Trpm4 UTSW 7 45319259 missense probably damaging 1.00
R8060:Trpm4 UTSW 7 45305451 missense probably damaging 1.00
R8119:Trpm4 UTSW 7 45327128 missense probably damaging 1.00
R8225:Trpm4 UTSW 7 45305334 missense probably benign
R8395:Trpm4 UTSW 7 45309210 missense probably benign 0.00
R8509:Trpm4 UTSW 7 45322361 missense probably damaging 1.00
R8897:Trpm4 UTSW 7 45310631 missense probably benign 0.02
R9577:Trpm4 UTSW 7 45305008 nonsense probably null
R9674:Trpm4 UTSW 7 45333387 missense possibly damaging 0.87
R9731:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
X0018:Trpm4 UTSW 7 45314634 missense possibly damaging 0.61
X0022:Trpm4 UTSW 7 45310511 missense probably damaging 1.00
Z1177:Trpm4 UTSW 7 45326718 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GACAAACGCAGATAGTGGCC -3'
(R):5'- GGGTTCATACTCTACCCTCATG -3'

Sequencing Primer
(F):5'- ACGCAGATAGTGGCCTAGAG -3'
(R):5'- TACCCTCATGCCCCCAGAGG -3'
Posted On 2018-04-02