Incidental Mutation 'R6302:Map6'
ID 509278
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 044467-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R6302 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98985314 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 406 (Q406R)
Ref Sequence ENSEMBL: ENSMUSP00000146954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: Q609R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: Q609R

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: Q609R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably damaging
Transcript: ENSMUST00000208924
AA Change: Q406R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 G T 4: 144,396,760 (GRCm39) S324* probably null Het
Actl11 T G 9: 107,806,772 (GRCm39) V365G probably benign Het
Adgrg6 T A 10: 14,317,227 (GRCm39) D531V probably benign Het
Ankrd11 A G 8: 123,616,728 (GRCm39) S2354P probably benign Het
Ano9 A T 7: 140,684,221 (GRCm39) W514R probably damaging Het
Arfgef3 A T 10: 18,528,589 (GRCm39) V266E probably damaging Het
Bahcc1 T C 11: 120,167,634 (GRCm39) I1345T probably damaging Het
Bpifb4 G A 2: 153,801,587 (GRCm39) M355I probably benign Het
Catsperb T C 12: 101,554,402 (GRCm39) S699P possibly damaging Het
Cdh23 T G 10: 60,140,872 (GRCm39) I3161L possibly damaging Het
Chd3 T C 11: 69,244,604 (GRCm39) T1257A probably damaging Het
Cnnm4 C T 1: 36,539,036 (GRCm39) T638I probably benign Het
Cspg4b A G 13: 113,504,646 (GRCm39) D1925G probably damaging Het
Cyp26c1 A G 19: 37,674,936 (GRCm39) T86A probably damaging Het
Cyp3a63-ps A G 5: 145,564,847 (GRCm39) noncoding transcript Het
Dnah14 T A 1: 181,428,771 (GRCm39) I259N possibly damaging Het
Dnah17 T C 11: 118,019,981 (GRCm39) D22G probably benign Het
Epn2 T G 11: 61,437,312 (GRCm39) T87P probably damaging Het
Fbxl18 A G 5: 142,874,578 (GRCm39) L81P probably damaging Het
Gas1 A T 13: 60,323,970 (GRCm39) D221E probably damaging Het
Gm8356 T C 14: 17,691,275 (GRCm39) Y130C probably damaging Het
Gpr151 T G 18: 42,712,459 (GRCm39) K73T probably damaging Het
Helq A C 5: 100,946,305 (GRCm39) V12G probably damaging Het
Inpp4b A G 8: 82,494,806 (GRCm39) T74A probably benign Het
Kirrel3 G A 9: 34,919,045 (GRCm39) V234I probably damaging Het
Kxd1 T A 8: 70,972,713 (GRCm39) probably null Het
Lif T C 11: 4,218,924 (GRCm39) Y68H probably damaging Het
Mcoln3 A T 3: 145,830,527 (GRCm39) M86L probably benign Het
Mei1 T A 15: 81,987,439 (GRCm39) Y834* probably null Het
Mroh1 T C 15: 76,320,319 (GRCm39) probably null Het
Myo15b T C 11: 115,777,065 (GRCm39) I2319T possibly damaging Het
Myo7b T G 18: 32,127,439 (GRCm39) D621A probably damaging Het
Naip5 C T 13: 100,359,674 (GRCm39) A521T possibly damaging Het
Nek7 T C 1: 138,426,351 (GRCm39) D254G probably damaging Het
Nsd2 A G 5: 34,024,921 (GRCm39) R560G possibly damaging Het
Or2t46 T C 11: 58,472,464 (GRCm39) F265L probably benign Het
Or52x1 A T 7: 104,852,926 (GRCm39) L208H probably damaging Het
Pbx1 T A 1: 168,018,910 (GRCm39) T312S probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Pitrm1 A G 13: 6,610,097 (GRCm39) S390G probably damaging Het
Plcxd3 C T 15: 4,546,239 (GRCm39) T81M probably damaging Het
Pmf1 C T 3: 88,307,017 (GRCm39) probably null Het
Rabep1 T C 11: 70,825,947 (GRCm39) V739A probably damaging Het
Rex2 A G 4: 147,142,451 (GRCm39) D313G possibly damaging Het
Rpia C T 6: 70,750,485 (GRCm39) V216I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Sec13 T A 6: 113,712,167 (GRCm39) H56L probably damaging Het
Sec16a A T 2: 26,315,817 (GRCm39) V1733D probably damaging Het
Sim2 G A 16: 93,898,089 (GRCm39) A108T probably damaging Het
Slc27a5 T C 7: 12,722,479 (GRCm39) D665G probably damaging Het
Slc38a6 T A 12: 73,383,849 (GRCm39) V180E probably damaging Het
Smarcad1 T G 6: 65,052,122 (GRCm39) N38K possibly damaging Het
Spem2 T C 11: 69,709,091 (GRCm39) T45A possibly damaging Het
Svil T C 18: 5,057,432 (GRCm39) S714P probably benign Het
Taar7b T A 10: 23,876,158 (GRCm39) S108T possibly damaging Het
Tbl3 T C 17: 24,923,645 (GRCm39) K256E probably benign Het
Tcam1 T G 11: 106,177,276 (GRCm39) C423G probably damaging Het
Trpm4 A T 7: 44,977,143 (GRCm39) probably null Het
Ttyh2 T C 11: 114,592,662 (GRCm39) C231R probably damaging Het
Ugt3a1 C T 15: 9,365,397 (GRCm39) P337S probably damaging Het
Vmn2r83 A C 10: 79,304,837 (GRCm39) T16P possibly damaging Het
Vps52 T C 17: 34,182,189 (GRCm39) F589S probably damaging Het
Xkr4 T C 1: 3,286,961 (GRCm39) T410A probably damaging Het
Xkr9 A G 1: 13,742,726 (GRCm39) T4A probably damaging Het
Yars2 T C 16: 16,122,438 (GRCm39) L268P probably damaging Het
Zbtb41 C A 1: 139,357,027 (GRCm39) N427K possibly damaging Het
Zeb2 T C 2: 44,887,771 (GRCm39) T414A probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGCCACATCTCATCAGG -3'
(R):5'- AGCTCAGATGCTATGTGGTC -3'

Sequencing Primer
(F):5'- ACATCTCATCAGGCAATCTGTG -3'
(R):5'- CTCAGATGCTATGTGGTCCTGAAC -3'
Posted On 2018-04-02