Incidental Mutation 'R6302:Taar7b'
ID509288
Institutional Source Beutler Lab
Gene Symbol Taar7b
Ensembl Gene ENSMUSG00000095171
Gene Nametrace amine-associated receptor 7B
SynonymsLOC209517
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6302 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23999939-24001015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24000260 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 108 (S108T)
Ref Sequence ENSEMBL: ENSMUSP00000090328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092658]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092658
AA Change: S108T

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090328
Gene: ENSMUSG00000095171
AA Change: S108T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 56 261 1.9e-7 PFAM
Pfam:7tm_1 64 326 7.3e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T G 9: 107,929,573 V365G probably benign Het
Adgrg6 T A 10: 14,441,483 D531V probably benign Het
Ankrd11 A G 8: 122,889,989 S2354P probably benign Het
Ano9 A T 7: 141,104,308 W514R probably damaging Het
Arfgef3 A T 10: 18,652,841 V266E probably damaging Het
Bahcc1 T C 11: 120,276,808 I1345T probably damaging Het
BC067074 A G 13: 113,368,112 D1925G probably damaging Het
Bpifb4 G A 2: 153,959,667 M355I probably benign Het
Catsperb T C 12: 101,588,143 S699P possibly damaging Het
Cdh23 T G 10: 60,305,093 I3161L possibly damaging Het
Chd3 T C 11: 69,353,778 T1257A probably damaging Het
Cnnm4 C T 1: 36,499,955 T638I probably benign Het
Cyp26c1 A G 19: 37,686,488 T86A probably damaging Het
Cyp3a63-ps A G 5: 145,628,037 noncoding transcript Het
Dnah14 T A 1: 181,601,206 I259N possibly damaging Het
Dnah17 T C 11: 118,129,155 D22G probably benign Het
Epn2 T G 11: 61,546,486 T87P probably damaging Het
Fbxl18 A G 5: 142,888,823 L81P probably damaging Het
Gas1 A T 13: 60,176,156 D221E probably damaging Het
Gm436 G T 4: 144,670,190 S324* probably null Het
Gm8356 T C 14: 6,535,128 Y130C probably damaging Het
Gpr151 T G 18: 42,579,394 K73T probably damaging Het
Helq A C 5: 100,798,439 V12G probably damaging Het
Inpp4b A G 8: 81,768,177 T74A probably benign Het
Kirrel3 G A 9: 35,007,749 V234I probably damaging Het
Kxd1 T A 8: 70,520,063 probably null Het
Lif T C 11: 4,268,924 Y68H probably damaging Het
Map6 A G 7: 99,336,107 Q406R probably damaging Het
Mcoln3 A T 3: 146,124,772 M86L probably benign Het
Mei1 T A 15: 82,103,238 Y834* probably null Het
Mroh1 T C 15: 76,436,119 probably null Het
Myo15b T C 11: 115,886,239 I2319T possibly damaging Het
Myo7b T G 18: 31,994,386 D621A probably damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nek7 T C 1: 138,498,613 D254G probably damaging Het
Nsd2 A G 5: 33,867,577 R560G possibly damaging Het
Olfr325 T C 11: 58,581,638 F265L probably benign Het
Olfr686 A T 7: 105,203,719 L208H probably damaging Het
Pbx1 T A 1: 168,191,341 T312S probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pitrm1 A G 13: 6,560,061 S390G probably damaging Het
Plcxd3 C T 15: 4,516,757 T81M probably damaging Het
Pmf1 C T 3: 88,399,710 probably null Het
Rabep1 T C 11: 70,935,121 V739A probably damaging Het
Rex2 A G 4: 147,057,994 D313G possibly damaging Het
Rpia C T 6: 70,773,501 V216I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sec13 T A 6: 113,735,206 H56L probably damaging Het
Sec16a A T 2: 26,425,805 V1733D probably damaging Het
Sim2 G A 16: 94,097,230 A108T probably damaging Het
Slc27a5 T C 7: 12,988,552 D665G probably damaging Het
Slc38a6 T A 12: 73,337,075 V180E probably damaging Het
Smarcad1 T G 6: 65,075,138 N38K possibly damaging Het
Spem2 T C 11: 69,818,265 T45A possibly damaging Het
Svil T C 18: 5,057,432 S714P probably benign Het
Tbl3 T C 17: 24,704,671 K256E probably benign Het
Tcam1 T G 11: 106,286,450 C423G probably damaging Het
Trpm4 A T 7: 45,327,719 probably null Het
Ttyh2 T C 11: 114,701,836 C231R probably damaging Het
Ugt3a2 C T 15: 9,365,311 P337S probably damaging Het
Vmn2r83 A C 10: 79,469,003 T16P possibly damaging Het
Vps52 T C 17: 33,963,215 F589S probably damaging Het
Xkr4 T C 1: 3,216,738 T410A probably damaging Het
Xkr9 A G 1: 13,672,502 T4A probably damaging Het
Yars2 T C 16: 16,304,574 L268P probably damaging Het
Zbtb41 C A 1: 139,429,289 N427K possibly damaging Het
Zeb2 T C 2: 44,997,759 T414A probably benign Het
Other mutations in Taar7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Taar7b APN 10 24000842 missense probably benign 0.01
IGL00771:Taar7b APN 10 24000198 missense probably benign 0.01
IGL01662:Taar7b APN 10 23999976 missense probably benign 0.02
IGL02186:Taar7b APN 10 23999981 missense probably benign 0.00
IGL02399:Taar7b APN 10 24000152 missense probably damaging 0.99
IGL02514:Taar7b APN 10 24000984 missense probably benign 0.00
IGL02601:Taar7b APN 10 24000306 missense probably damaging 1.00
IGL02717:Taar7b APN 10 24000360 missense probably damaging 1.00
IGL02724:Taar7b APN 10 24000683 missense probably benign
IGL02725:Taar7b APN 10 24000063 missense probably benign 0.03
R0103:Taar7b UTSW 10 24000294 missense probably benign 0.00
R2060:Taar7b UTSW 10 24000675 missense possibly damaging 0.95
R4973:Taar7b UTSW 10 24000345 missense probably benign 0.08
R5055:Taar7b UTSW 10 24000947 missense possibly damaging 0.75
R5068:Taar7b UTSW 10 24000461 missense probably benign 0.00
R5069:Taar7b UTSW 10 24000461 missense probably benign 0.00
R5070:Taar7b UTSW 10 24000461 missense probably benign 0.00
R5205:Taar7b UTSW 10 24000018 missense probably benign 0.05
R5994:Taar7b UTSW 10 24000348 missense probably damaging 1.00
R6131:Taar7b UTSW 10 24000717 missense probably benign 0.20
R6332:Taar7b UTSW 10 23999951 missense probably benign 0.05
R6809:Taar7b UTSW 10 24000858 missense probably benign 0.03
R7126:Taar7b UTSW 10 24000062 missense possibly damaging 0.93
R7520:Taar7b UTSW 10 24000483 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTCAGGAGCCCATATTCC -3'
(R):5'- AGGTGATGCACTTGCCAGAAAC -3'

Sequencing Primer
(F):5'- AGGAGCCCATATTCCCCAGG -3'
(R):5'- TGATGCACTTGCCAGAAACAAATG -3'
Posted On2018-04-02