Mutagenetix > Incidental Mutation

Incidental Mutation 'R6302:Naip5'

509306

Institutional Source

Beutler Lab

Gene Symbol

Naip5

Ensembl Gene

ENSMUSG00000071203

Gene Name

NLR family, apoptosis inhibitory protein 5

Synonyms

Birc1e, Lgn1, Naip-rs3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R6302 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100211739-100246323 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 100223166 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 521 (A521T)

Ref Sequence

ENSEMBL: ENSMUSP00000058611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049789]

AlphaFold

Q9R016

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049789
AA Change: A521T

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: A521T

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
BIR	58	129	1.08e-19	SMART
BIR	157	229	1.06e-36	SMART
BIR	276	347	2.14e-32	SMART
Pfam:NACHT	464	618	1.7e-36	PFAM
low complexity region	851	862	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl11	T	G	9: 107,929,573	V365G	probably benign	Het
Adgrg6	T	A	10: 14,441,483	D531V	probably benign	Het
Ankrd11	A	G	8: 122,889,989	S2354P	probably benign	Het
Ano9	A	T	7: 141,104,308	W514R	probably damaging	Het
Arfgef3	A	T	10: 18,652,841	V266E	probably damaging	Het
Bahcc1	T	C	11: 120,276,808	I1345T	probably damaging	Het
BC067074	A	G	13: 113,368,112	D1925G	probably damaging	Het
Bpifb4	G	A	2: 153,959,667	M355I	probably benign	Het
Catsperb	T	C	12: 101,588,143	S699P	possibly damaging	Het
Cdh23	T	G	10: 60,305,093	I3161L	possibly damaging	Het
Chd3	T	C	11: 69,353,778	T1257A	probably damaging	Het
Cnnm4	C	T	1: 36,499,955	T638I	probably benign	Het
Cyp26c1	A	G	19: 37,686,488	T86A	probably damaging	Het
Cyp3a63-ps	A	G	5: 145,628,037		noncoding transcript	Het
Dnah14	T	A	1: 181,601,206	I259N	possibly damaging	Het
Dnah17	T	C	11: 118,129,155	D22G	probably benign	Het
Epn2	T	G	11: 61,546,486	T87P	probably damaging	Het
Fbxl18	A	G	5: 142,888,823	L81P	probably damaging	Het
Gas1	A	T	13: 60,176,156	D221E	probably damaging	Het
Gm436	G	T	4: 144,670,190	S324*	probably null	Het
Gm8356	T	C	14: 6,535,128	Y130C	probably damaging	Het
Gpr151	T	G	18: 42,579,394	K73T	probably damaging	Het
Helq	A	C	5: 100,798,439	V12G	probably damaging	Het
Inpp4b	A	G	8: 81,768,177	T74A	probably benign	Het
Kirrel3	G	A	9: 35,007,749	V234I	probably damaging	Het
Kxd1	T	A	8: 70,520,063		probably null	Het
Lif	T	C	11: 4,268,924	Y68H	probably damaging	Het
Map6	A	G	7: 99,336,107	Q406R	probably damaging	Het
Mcoln3	A	T	3: 146,124,772	M86L	probably benign	Het
Mei1	T	A	15: 82,103,238	Y834*	probably null	Het
Mroh1	T	C	15: 76,436,119		probably null	Het
Myo15b	T	C	11: 115,886,239	I2319T	possibly damaging	Het
Myo7b	T	G	18: 31,994,386	D621A	probably damaging	Het
Nek7	T	C	1: 138,498,613	D254G	probably damaging	Het
Nsd2	A	G	5: 33,867,577	R560G	possibly damaging	Het
Olfr325	T	C	11: 58,581,638	F265L	probably benign	Het
Olfr686	A	T	7: 105,203,719	L208H	probably damaging	Het
Pbx1	T	A	1: 168,191,341	T312S	probably benign	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Pitrm1	A	G	13: 6,560,061	S390G	probably damaging	Het
Plcxd3	C	T	15: 4,516,757	T81M	probably damaging	Het
Pmf1	C	T	3: 88,399,710		probably null	Het
Rabep1	T	C	11: 70,935,121	V739A	probably damaging	Het
Rex2	A	G	4: 147,057,994	D313G	possibly damaging	Het
Rpia	C	T	6: 70,773,501	V216I	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Sec13	T	A	6: 113,735,206	H56L	probably damaging	Het
Sec16a	A	T	2: 26,425,805	V1733D	probably damaging	Het
Sim2	G	A	16: 94,097,230	A108T	probably damaging	Het
Slc27a5	T	C	7: 12,988,552	D665G	probably damaging	Het
Slc38a6	T	A	12: 73,337,075	V180E	probably damaging	Het
Smarcad1	T	G	6: 65,075,138	N38K	possibly damaging	Het
Spem2	T	C	11: 69,818,265	T45A	possibly damaging	Het
Svil	T	C	18: 5,057,432	S714P	probably benign	Het
Taar7b	T	A	10: 24,000,260	S108T	possibly damaging	Het
Tbl3	T	C	17: 24,704,671	K256E	probably benign	Het
Tcam1	T	G	11: 106,286,450	C423G	probably damaging	Het
Trpm4	A	T	7: 45,327,719		probably null	Het
Ttyh2	T	C	11: 114,701,836	C231R	probably damaging	Het
Ugt3a2	C	T	15: 9,365,311	P337S	probably damaging	Het
Vmn2r83	A	C	10: 79,469,003	T16P	possibly damaging	Het
Vps52	T	C	17: 33,963,215	F589S	probably damaging	Het
Xkr4	T	C	1: 3,216,738	T410A	probably damaging	Het
Xkr9	A	G	1: 13,672,502	T4A	probably damaging	Het
Yars2	T	C	16: 16,304,574	L268P	probably damaging	Het
Zbtb41	C	A	1: 139,429,289	N427K	possibly damaging	Het
Zeb2	T	C	2: 44,997,759	T414A	probably benign	Het

Other mutations in Naip5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Naip5	APN	13	100246175	nonsense	probably null
IGL00493:Naip5	APN	13	100230771	missense	probably damaging	0.96
IGL01294:Naip5	APN	13	100217080	missense	probably damaging	0.99
IGL01405:Naip5	APN	13	100221945	missense	probably benign	0.11
IGL01568:Naip5	APN	13	100217101	missense	probably benign	0.26
IGL01804:Naip5	APN	13	100221584	missense	probably damaging	1.00
IGL02012:Naip5	APN	13	100223339	missense	probably benign	0.01
IGL02183:Naip5	APN	13	100221642	missense	probably benign	0.41
IGL02449:Naip5	APN	13	100222175	missense	probably benign	0.34
IGL02815:Naip5	APN	13	100222731	missense	probably benign
IGL02992:Naip5	APN	13	100223028	missense	probably damaging	1.00
IGL03027:Naip5	APN	13	100223016	missense	probably benign	0.00
IGL03234:Naip5	APN	13	100212627	missense	probably damaging	1.00
inwood2	UTSW	13	100223014	nonsense	probably null
inwood3	UTSW	13	100221903	nonsense	probably null
Nuchal	UTSW	13	100214663	missense	possibly damaging	0.82
PIT4131001:Naip5	UTSW	13	100219739	missense	probably benign
PIT4131001:Naip5	UTSW	13	100219760	missense	probably benign	0.00
R0001:Naip5	UTSW	13	100214650	critical splice donor site	probably null
R0001:Naip5	UTSW	13	100223114	missense	probably benign
R0462:Naip5	UTSW	13	100221732	missense	probably damaging	1.00
R0636:Naip5	UTSW	13	100219688	missense	probably benign
R0674:Naip5	UTSW	13	100223199	missense	probably benign	0.04
R0764:Naip5	UTSW	13	100217105	missense	probably benign	0.03
R0837:Naip5	UTSW	13	100230743	missense	probably benign
R1179:Naip5	UTSW	13	100219830	missense	probably benign
R1302:Naip5	UTSW	13	100221591	missense	possibly damaging	0.91
R1441:Naip5	UTSW	13	100219717	missense	possibly damaging	0.95
R1513:Naip5	UTSW	13	100222206	missense	probably benign
R1638:Naip5	UTSW	13	100212669	missense	probably damaging	1.00
R1651:Naip5	UTSW	13	100221911	missense	probably benign	0.41
R1707:Naip5	UTSW	13	100242855	missense	probably damaging	1.00
R1835:Naip5	UTSW	13	100223218	nonsense	probably null
R1836:Naip5	UTSW	13	100219687	missense	probably benign	0.18
R1972:Naip5	UTSW	13	100212770	missense	probably damaging	0.98
R2080:Naip5	UTSW	13	100221533	missense	probably damaging	1.00
R2333:Naip5	UTSW	13	100223171	missense	probably damaging	1.00
R2348:Naip5	UTSW	13	100219738	missense	probably benign	0.01
R3055:Naip5	UTSW	13	100221878	missense	probably benign	0.23
R3401:Naip5	UTSW	13	100221903	nonsense	probably null
R3723:Naip5	UTSW	13	100223014	nonsense	probably null
R3775:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R3775:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4019:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R4019:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4020:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R4020:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4074:Naip5	UTSW	13	100246064	missense	probably damaging	1.00
R4082:Naip5	UTSW	13	100245830	missense	probably damaging	1.00
R4105:Naip5	UTSW	13	100219739	missense	probably benign
R4227:Naip5	UTSW	13	100212768	missense	probably damaging	0.99
R4639:Naip5	UTSW	13	100219830	missense	probably benign
R4640:Naip5	UTSW	13	100219830	missense	probably benign
R4641:Naip5	UTSW	13	100219830	missense	probably benign
R4644:Naip5	UTSW	13	100219830	missense	probably benign
R4645:Naip5	UTSW	13	100219830	missense	probably benign
R4700:Naip5	UTSW	13	100223414	missense	possibly damaging	0.62
R4727:Naip5	UTSW	13	100221870	missense	possibly damaging	0.81
R4729:Naip5	UTSW	13	100222131	missense	possibly damaging	0.75
R4816:Naip5	UTSW	13	100219681	missense	probably benign	0.32
R4816:Naip5	UTSW	13	100219687	missense	probably benign	0.01
R4816:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R4869:Naip5	UTSW	13	100245131	missense	probably damaging	1.00
R5162:Naip5	UTSW	13	100223406	missense	possibly damaging	0.78
R5244:Naip5	UTSW	13	100245662	missense	probably benign	0.08
R5411:Naip5	UTSW	13	100245746	missense	possibly damaging	0.54
R5632:Naip5	UTSW	13	100230662	splice site	probably null
R5760:Naip5	UTSW	13	100242838	missense	probably damaging	1.00
R5916:Naip5	UTSW	13	100222701	missense	probably benign	0.02
R6304:Naip5	UTSW	13	100223166	missense	possibly damaging	0.76
R6411:Naip5	UTSW	13	100223405	missense	probably benign	0.01
R6474:Naip5	UTSW	13	100214663	missense	possibly damaging	0.82
R6499:Naip5	UTSW	13	100221594	missense	probably benign
R6544:Naip5	UTSW	13	100223144	missense	possibly damaging	0.50
R6827:Naip5	UTSW	13	100245929	missense	possibly damaging	0.48
R6954:Naip5	UTSW	13	100223414	missense	probably damaging	0.99
R7052:Naip5	UTSW	13	100222347	missense	probably benign	0.01
R7138:Naip5	UTSW	13	100219830	missense	probably benign
R7141:Naip5	UTSW	13	100219830	missense	probably benign
R7375:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7375:Naip5	UTSW	13	100219697	missense	not run
R7401:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7401:Naip5	UTSW	13	100219697	missense	not run
R7447:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7447:Naip5	UTSW	13	100219697	missense	not run
R7466:Naip5	UTSW	13	100221986	nonsense	probably null
R7491:Naip5	UTSW	13	100217071	missense	probably benign	0.18
R7559:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7559:Naip5	UTSW	13	100219697	missense	not run
R7562:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7562:Naip5	UTSW	13	100219697	missense	not run
R7588:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7588:Naip5	UTSW	13	100219697	missense	not run
R7589:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7589:Naip5	UTSW	13	100219697	missense	not run
R7590:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7590:Naip5	UTSW	13	100219697	missense	not run
R7742:Naip5	UTSW	13	100219830	missense	probably benign
R7886:Naip5	UTSW	13	100246181	missense	probably benign	0.28
R7996:Naip5	UTSW	13	100221656	missense	probably damaging	1.00
R8026:Naip5	UTSW	13	100245898	missense	probably damaging	1.00
R8046:Naip5	UTSW	13	100222233	missense	probably benign
R8319:Naip5	UTSW	13	100221659	missense	probably benign	0.12
R8471:Naip5	UTSW	13	100221645	missense	probably damaging	0.99
R8480:Naip5	UTSW	13	100222235	missense	probably damaging	1.00
R8496:Naip5	UTSW	13	100212739	missense	probably benign	0.00
R8500:Naip5	UTSW	13	100222712	missense	probably damaging	0.98
R8712:Naip5	UTSW	13	100223096	missense	possibly damaging	0.61
R8780:Naip5	UTSW	13	100219830	missense	probably benign
R8781:Naip5	UTSW	13	100219830	missense	probably benign
R8788:Naip5	UTSW	13	100219830	missense	probably benign
R8817:Naip5	UTSW	13	100212699	missense	probably benign	0.01
R8833:Naip5	UTSW	13	100222934	missense	probably damaging	0.97
R8835:Naip5	UTSW	13	100219830	missense	probably benign
R8958:Naip5	UTSW	13	100217609	nonsense	probably null
R9031:Naip5	UTSW	13	100219830	missense	probably benign
R9032:Naip5	UTSW	13	100219830	missense	probably benign
R9074:Naip5	UTSW	13	100221756	missense	possibly damaging	0.92
R9098:Naip5	UTSW	13	100229619	missense	possibly damaging	0.67
R9204:Naip5	UTSW	13	100222500	missense	probably damaging	1.00
R9223:Naip5	UTSW	13	100227676	missense	probably benign	0.05
R9358:Naip5	UTSW	13	100219830	missense	probably benign
R9389:Naip5	UTSW	13	100219830	missense	probably benign
R9403:Naip5	UTSW	13	100219830	missense	probably benign
R9518:Naip5	UTSW	13	100221859	missense	probably benign
R9568:Naip5	UTSW	13	100219830	missense	probably benign
R9568:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9569:Naip5	UTSW	13	100219830	missense	probably benign
R9569:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9570:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9572:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9581:Naip5	UTSW	13	100214686	missense	probably benign	0.11
R9627:Naip5	UTSW	13	100219830	missense	probably benign
R9725:Naip5	UTSW	13	100222276	missense	possibly damaging	0.94
R9763:Naip5	UTSW	13	100230761	missense	probably damaging	0.99
R9764:Naip5	UTSW	13	100230761	missense	probably damaging	0.99
R9765:Naip5	UTSW	13	100230761	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAATAAGCAGGTCCGTGAC -3'
(R):5'- TCAGCTGCGATGTGTCCATC -3'

Sequencing Primer
(F):5'- TCAATAAGCAGGTCCGTGACAAGTAG -3'
(R):5'- GCGATGTGTCCATCATTTCAAAGC -3'

Posted On

2018-04-02