Incidental Mutation 'R6302:Myo7b'
ID509318
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6302 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 31994386 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 621 (D621A)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
Predicted Effect probably damaging
Transcript: ENSMUST00000134663
AA Change: D621A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: D621A

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T G 9: 107,929,573 V365G probably benign Het
Adgrg6 T A 10: 14,441,483 D531V probably benign Het
Ankrd11 A G 8: 122,889,989 S2354P probably benign Het
Ano9 A T 7: 141,104,308 W514R probably damaging Het
Arfgef3 A T 10: 18,652,841 V266E probably damaging Het
Bahcc1 T C 11: 120,276,808 I1345T probably damaging Het
BC067074 A G 13: 113,368,112 D1925G probably damaging Het
Bpifb4 G A 2: 153,959,667 M355I probably benign Het
Catsperb T C 12: 101,588,143 S699P possibly damaging Het
Cdh23 T G 10: 60,305,093 I3161L possibly damaging Het
Chd3 T C 11: 69,353,778 T1257A probably damaging Het
Cnnm4 C T 1: 36,499,955 T638I probably benign Het
Cyp26c1 A G 19: 37,686,488 T86A probably damaging Het
Cyp3a63-ps A G 5: 145,628,037 noncoding transcript Het
Dnah14 T A 1: 181,601,206 I259N possibly damaging Het
Dnah17 T C 11: 118,129,155 D22G probably benign Het
Epn2 T G 11: 61,546,486 T87P probably damaging Het
Fbxl18 A G 5: 142,888,823 L81P probably damaging Het
Gas1 A T 13: 60,176,156 D221E probably damaging Het
Gm436 G T 4: 144,670,190 S324* probably null Het
Gm8356 T C 14: 6,535,128 Y130C probably damaging Het
Gpr151 T G 18: 42,579,394 K73T probably damaging Het
Helq A C 5: 100,798,439 V12G probably damaging Het
Inpp4b A G 8: 81,768,177 T74A probably benign Het
Kirrel3 G A 9: 35,007,749 V234I probably damaging Het
Kxd1 T A 8: 70,520,063 probably null Het
Lif T C 11: 4,268,924 Y68H probably damaging Het
Map6 A G 7: 99,336,107 Q406R probably damaging Het
Mcoln3 A T 3: 146,124,772 M86L probably benign Het
Mei1 T A 15: 82,103,238 Y834* probably null Het
Mroh1 T C 15: 76,436,119 probably null Het
Myo15b T C 11: 115,886,239 I2319T possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nek7 T C 1: 138,498,613 D254G probably damaging Het
Nsd2 A G 5: 33,867,577 R560G possibly damaging Het
Olfr325 T C 11: 58,581,638 F265L probably benign Het
Olfr686 A T 7: 105,203,719 L208H probably damaging Het
Pbx1 T A 1: 168,191,341 T312S probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pitrm1 A G 13: 6,560,061 S390G probably damaging Het
Plcxd3 C T 15: 4,516,757 T81M probably damaging Het
Pmf1 C T 3: 88,399,710 probably null Het
Rabep1 T C 11: 70,935,121 V739A probably damaging Het
Rex2 A G 4: 147,057,994 D313G possibly damaging Het
Rpia C T 6: 70,773,501 V216I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sec13 T A 6: 113,735,206 H56L probably damaging Het
Sec16a A T 2: 26,425,805 V1733D probably damaging Het
Sim2 G A 16: 94,097,230 A108T probably damaging Het
Slc27a5 T C 7: 12,988,552 D665G probably damaging Het
Slc38a6 T A 12: 73,337,075 V180E probably damaging Het
Smarcad1 T G 6: 65,075,138 N38K possibly damaging Het
Spem2 T C 11: 69,818,265 T45A possibly damaging Het
Svil T C 18: 5,057,432 S714P probably benign Het
Taar7b T A 10: 24,000,260 S108T possibly damaging Het
Tbl3 T C 17: 24,704,671 K256E probably benign Het
Tcam1 T G 11: 106,286,450 C423G probably damaging Het
Trpm4 A T 7: 45,327,719 probably null Het
Ttyh2 T C 11: 114,701,836 C231R probably damaging Het
Ugt3a2 C T 15: 9,365,311 P337S probably damaging Het
Vmn2r83 A C 10: 79,469,003 T16P possibly damaging Het
Vps52 T C 17: 33,963,215 F589S probably damaging Het
Xkr4 T C 1: 3,216,738 T410A probably damaging Het
Xkr9 A G 1: 13,672,502 T4A probably damaging Het
Yars2 T C 16: 16,304,574 L268P probably damaging Het
Zbtb41 C A 1: 139,429,289 N427K possibly damaging Het
Zeb2 T C 2: 44,997,759 T414A probably benign Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
R8841:Myo7b UTSW 18 31964437 missense probably benign 0.06
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTAGGTGTCAAACTCAGCCC -3'
(R):5'- ATGCAGCATCCCAGCATGTAG -3'

Sequencing Primer
(F):5'- TGTCAAACTCAGCCCCTCGG -3'
(R):5'- CATGTAGCTTGTCCTGGAATGAAG -3'
Posted On2018-04-02