Incidental Mutation 'R6319:Plekhm3'
ID509322
Institutional Source Beutler Lab
Gene Symbol Plekhm3
Ensembl Gene ENSMUSG00000051344
Gene Namepleckstrin homology domain containing, family M, member 3
Synonyms9430067K14Rik, A230102O09Rik, Plekhm1l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R6319 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location64785983-64956824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64921934 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 388 (Y388N)
Ref Sequence ENSEMBL: ENSMUSP00000138002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097713] [ENSMUST00000139649]
Predicted Effect probably benign
Transcript: ENSMUST00000097713
AA Change: Y388N

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095320
Gene: ENSMUSG00000051344
AA Change: Y388N

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139649
AA Change: Y388N

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138002
Gene: ENSMUSG00000051344
AA Change: Y388N

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140857
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,685,401 R233C probably benign Het
Abcg2 T C 6: 58,674,738 S372P probably benign Het
Adam34 A G 8: 43,651,915 I231T probably benign Het
Adgrg6 T A 10: 14,431,622 H840L probably damaging Het
Akap11 T C 14: 78,513,538 T470A probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B430306N03Rik A T 17: 48,316,743 Q24L probably damaging Het
Bmp6 A T 13: 38,346,414 H161L probably benign Het
Cdca8 C A 4: 124,921,294 D177Y possibly damaging Het
Col14a1 A G 15: 55,516,169 T1693A probably damaging Het
Cpsf1 A G 15: 76,596,967 S1230P probably damaging Het
Dcaf13 A G 15: 39,143,672 T334A probably benign Het
Dhx32 A C 7: 133,737,226 V360G probably damaging Het
Dmxl1 A G 18: 49,852,300 T205A probably benign Het
Dxo A G 17: 34,838,391 E253G probably damaging Het
Enpp1 T C 10: 24,648,031 Y747C probably damaging Het
Gga2 T C 7: 122,002,166 E238G possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Grik4 A T 9: 42,566,336 M518K probably damaging Het
Igf2r T A 17: 12,714,113 S841C probably damaging Het
Itfg1 G T 8: 85,840,629 T37K probably damaging Het
Kcnn4 T A 7: 24,381,740 M301K possibly damaging Het
Kel C A 6: 41,702,447 E127D probably benign Het
Lrp4 A G 2: 91,480,321 Y569C probably damaging Het
Lrp6 A T 6: 134,541,835 V89D possibly damaging Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Mnd1 A G 3: 84,141,764 S2P possibly damaging Het
Neb T A 2: 52,163,011 probably null Het
Olfr146 A G 9: 39,019,514 V9A probably damaging Het
Olfr191 A G 16: 59,086,021 I154T probably benign Het
Olfr609 T C 7: 103,492,725 E51G possibly damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Prr18 G T 17: 8,341,311 V100F probably damaging Het
Rnf25 T C 1: 74,595,731 Y44C probably damaging Het
Smg6 T C 11: 75,156,222 L1247P probably damaging Het
Tdh T C 14: 63,495,737 T137A probably benign Het
Tmem200a A G 10: 25,993,495 V292A probably damaging Het
Ubr3 T C 2: 69,973,414 V1116A probably benign Het
Ubr4 G A 4: 139,408,889 E942K possibly damaging Het
Unc5b G A 10: 60,778,801 A239V probably damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Vmn2r115 A G 17: 23,347,903 E463G possibly damaging Het
Other mutations in Plekhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Plekhm3 APN 1 64921832 missense probably damaging 1.00
IGL01732:Plekhm3 APN 1 64922248 missense probably benign 0.44
IGL02422:Plekhm3 APN 1 64921866 nonsense probably null
IGL02724:Plekhm3 APN 1 64795117 missense probably damaging 0.97
IGL03226:Plekhm3 APN 1 64921800 missense possibly damaging 0.58
IGL03250:Plekhm3 APN 1 64938047 missense possibly damaging 0.65
R0124:Plekhm3 UTSW 1 64921751 missense probably damaging 0.99
R1336:Plekhm3 UTSW 1 64937781 small deletion probably benign
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1560:Plekhm3 UTSW 1 64937817 missense probably benign 0.03
R1901:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2328:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2432:Plekhm3 UTSW 1 64937856 missense probably damaging 1.00
R2568:Plekhm3 UTSW 1 64937781 small deletion probably benign
R3023:Plekhm3 UTSW 1 64937781 small deletion probably benign
R4496:Plekhm3 UTSW 1 64861236 missense probably damaging 1.00
R4529:Plekhm3 UTSW 1 64937825 missense probably benign 0.14
R4682:Plekhm3 UTSW 1 64937927 missense possibly damaging 0.94
R4969:Plekhm3 UTSW 1 64937919 missense probably damaging 1.00
R5347:Plekhm3 UTSW 1 64819990 missense probably damaging 1.00
R5553:Plekhm3 UTSW 1 64921886 missense possibly damaging 0.89
R5583:Plekhm3 UTSW 1 64937986 nonsense probably null
R5953:Plekhm3 UTSW 1 64937895 missense probably damaging 0.98
R6970:Plekhm3 UTSW 1 64892753 missense possibly damaging 0.80
R7014:Plekhm3 UTSW 1 64883270 missense probably damaging 1.00
R7408:Plekhm3 UTSW 1 64937984 missense probably benign 0.02
R7570:Plekhm3 UTSW 1 64937906 missense probably damaging 1.00
R7663:Plekhm3 UTSW 1 64883208 missense probably damaging 0.98
R7719:Plekhm3 UTSW 1 64921742 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGGTTTTGCTCAGAACTCCTTG -3'
(R):5'- GTGACTGTGCACAGAACCAC -3'

Sequencing Primer
(F):5'- AGAACTCCTTGCAGCGTTG -3'
(R):5'- CCACTGTTTACAGAAGAAATCCAGTG -3'
Posted On2018-04-02