Incidental Mutation 'R6319:Kcnn4'
ID509335
Institutional Source Beutler Lab
Gene Symbol Kcnn4
Ensembl Gene ENSMUSG00000054342
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
SynonymsKCa3.1, IK1, SK4, IKCa1, mIKCa1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R6319 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location24370263-24386690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24381740 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 301 (M301K)
Ref Sequence ENSEMBL: ENSMUSP00000146012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171904] [ENSMUST00000205428] [ENSMUST00000205626]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171904
AA Change: M301K

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133065
Gene: ENSMUSG00000054342
AA Change: M301K

DomainStartEndE-ValueType
Pfam:SK_channel 11 124 1.7e-41 PFAM
low complexity region 143 160 N/A INTRINSIC
Pfam:Ion_trans_2 209 289 2.6e-16 PFAM
CaMBD 302 375 1.85e-32 SMART
low complexity region 411 424 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205428
AA Change: M301K

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000205626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206910
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a potentially heterotetrameric voltage-independent potassium channel that is activated by intracellular calcium. Activation is followed by membrane hyperpolarization, which promotes calcium influx. The encoded protein may be part of the predominant calcium-activated potassium channel in T-lymphocytes. This gene is similar to other KCNN family potassium channel genes, but it differs enough to possibly be considered as part of a new subfamily. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice have increased parotid gland weight and both sexes have impaired volume regulation in erythrocytes and T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,685,401 R233C probably benign Het
Abcg2 T C 6: 58,674,738 S372P probably benign Het
Adam34 A G 8: 43,651,915 I231T probably benign Het
Adgrg6 T A 10: 14,431,622 H840L probably damaging Het
Akap11 T C 14: 78,513,538 T470A probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B430306N03Rik A T 17: 48,316,743 Q24L probably damaging Het
Bmp6 A T 13: 38,346,414 H161L probably benign Het
Cdca8 C A 4: 124,921,294 D177Y possibly damaging Het
Col14a1 A G 15: 55,516,169 T1693A probably damaging Het
Cpsf1 A G 15: 76,596,967 S1230P probably damaging Het
Dcaf13 A G 15: 39,143,672 T334A probably benign Het
Dhx32 A C 7: 133,737,226 V360G probably damaging Het
Dmxl1 A G 18: 49,852,300 T205A probably benign Het
Dxo A G 17: 34,838,391 E253G probably damaging Het
Enpp1 T C 10: 24,648,031 Y747C probably damaging Het
Gga2 T C 7: 122,002,166 E238G possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Grik4 A T 9: 42,566,336 M518K probably damaging Het
Igf2r T A 17: 12,714,113 S841C probably damaging Het
Itfg1 G T 8: 85,840,629 T37K probably damaging Het
Kel C A 6: 41,702,447 E127D probably benign Het
Lrp4 A G 2: 91,480,321 Y569C probably damaging Het
Lrp6 A T 6: 134,541,835 V89D possibly damaging Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Mnd1 A G 3: 84,141,764 S2P possibly damaging Het
Neb T A 2: 52,163,011 probably null Het
Olfr146 A G 9: 39,019,514 V9A probably damaging Het
Olfr191 A G 16: 59,086,021 I154T probably benign Het
Olfr609 T C 7: 103,492,725 E51G possibly damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Plekhm3 A T 1: 64,921,934 Y388N probably benign Het
Prr18 G T 17: 8,341,311 V100F probably damaging Het
Rnf25 T C 1: 74,595,731 Y44C probably damaging Het
Smg6 T C 11: 75,156,222 L1247P probably damaging Het
Tdh T C 14: 63,495,737 T137A probably benign Het
Tmem200a A G 10: 25,993,495 V292A probably damaging Het
Ubr3 T C 2: 69,973,414 V1116A probably benign Het
Ubr4 G A 4: 139,408,889 E942K possibly damaging Het
Unc5b G A 10: 60,778,801 A239V probably damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Vmn2r115 A G 17: 23,347,903 E463G possibly damaging Het
Other mutations in Kcnn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Kcnn4 APN 7 24381703 missense probably benign 0.05
IGL02958:Kcnn4 APN 7 24374745 missense probably benign 0.00
ivanhoe UTSW 7 24374742 missense probably damaging 1.00
longbow UTSW 7 24379255 missense possibly damaging 0.88
R0009:Kcnn4 UTSW 7 24379255 missense possibly damaging 0.88
R1706:Kcnn4 UTSW 7 24374742 missense probably damaging 1.00
R4300:Kcnn4 UTSW 7 24377604 missense probably benign 0.21
R4402:Kcnn4 UTSW 7 24377442 missense probably benign 0.12
R5455:Kcnn4 UTSW 7 24377553 missense probably damaging 1.00
R5811:Kcnn4 UTSW 7 24377605 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGGCAGTGGCTGAACCTG -3'
(R):5'- ACGCTTTAAGGGGAACTGGC -3'

Sequencing Primer
(F):5'- TGAACCTGGCCTCTGTGG -3'
(R):5'- AGCTGAGGACTATCTTGAACTCCTG -3'
Posted On2018-04-02