Incidental Mutation 'R6319:Olfr146'
ID 509342
Institutional Source Beutler Lab
Gene Symbol Olfr146
Ensembl Gene ENSMUSG00000058820
Gene Name olfactory receptor 146
Synonyms GA_x6K02T2PVTD-32715386-32714466, MOR171-10, M15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R6319 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 39018073-39023377 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39019514 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000149294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073671] [ENSMUST00000214369] [ENSMUST00000214410] [ENSMUST00000215383]
AlphaFold Q60884
Predicted Effect probably damaging
Transcript: ENSMUST00000073671
AA Change: V9A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073352
Gene: ENSMUSG00000058820
AA Change: V9A

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.6e-54 PFAM
Pfam:7tm_1 41 290 8.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214369
AA Change: V9A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000214410
AA Change: V9A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215383
AA Change: V9A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.2615 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,685,401 R233C probably benign Het
Abcg2 T C 6: 58,674,738 S372P probably benign Het
Adam34 A G 8: 43,651,915 I231T probably benign Het
Adgrg6 T A 10: 14,431,622 H840L probably damaging Het
Akap11 T C 14: 78,513,538 T470A probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B430306N03Rik A T 17: 48,316,743 Q24L probably damaging Het
Bmp6 A T 13: 38,346,414 H161L probably benign Het
Cdca8 C A 4: 124,921,294 D177Y possibly damaging Het
Col14a1 A G 15: 55,516,169 T1693A probably damaging Het
Cpsf1 A G 15: 76,596,967 S1230P probably damaging Het
Dcaf13 A G 15: 39,143,672 T334A probably benign Het
Dhx32 A C 7: 133,737,226 V360G probably damaging Het
Dmxl1 A G 18: 49,852,300 T205A probably benign Het
Dxo A G 17: 34,838,391 E253G probably damaging Het
Enpp1 T C 10: 24,648,031 Y747C probably damaging Het
Gga2 T C 7: 122,002,166 E238G possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Grik4 A T 9: 42,566,336 M518K probably damaging Het
Igf2r T A 17: 12,714,113 S841C probably damaging Het
Itfg1 G T 8: 85,840,629 T37K probably damaging Het
Kcnn4 T A 7: 24,381,740 M301K possibly damaging Het
Kel C A 6: 41,702,447 E127D probably benign Het
Lrp4 A G 2: 91,480,321 Y569C probably damaging Het
Lrp6 A T 6: 134,541,835 V89D possibly damaging Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Mnd1 A G 3: 84,141,764 S2P possibly damaging Het
Neb T A 2: 52,163,011 probably null Het
Olfr191 A G 16: 59,086,021 I154T probably benign Het
Olfr609 T C 7: 103,492,725 E51G possibly damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Plekhm3 A T 1: 64,921,934 Y388N probably benign Het
Prr18 G T 17: 8,341,311 V100F probably damaging Het
Rnf25 T C 1: 74,595,731 Y44C probably damaging Het
Smg6 T C 11: 75,156,222 L1247P probably damaging Het
Tdh T C 14: 63,495,737 T137A probably benign Het
Tmem200a A G 10: 25,993,495 V292A probably damaging Het
Ubr3 T C 2: 69,973,414 V1116A probably benign Het
Ubr4 G A 4: 139,408,889 E942K possibly damaging Het
Unc5b G A 10: 60,778,801 A239V probably damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Vmn2r115 A G 17: 23,347,903 E463G possibly damaging Het
Other mutations in Olfr146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Olfr146 APN 9 39018801 missense probably damaging 0.98
IGL01655:Olfr146 APN 9 39018918 missense probably benign 0.00
IGL01804:Olfr146 APN 9 39019401 missense probably benign 0.13
IGL02098:Olfr146 APN 9 39018891 missense probably damaging 1.00
IGL02719:Olfr146 APN 9 39019016 missense probably benign 0.11
R0531:Olfr146 UTSW 9 39019176 missense probably damaging 0.97
R1270:Olfr146 UTSW 9 39019247 missense possibly damaging 0.90
R1511:Olfr146 UTSW 9 39019025 missense probably benign 0.03
R1590:Olfr146 UTSW 9 39018957 missense probably benign 0.09
R1649:Olfr146 UTSW 9 39019480 missense probably benign 0.03
R3419:Olfr146 UTSW 9 39019076 missense probably benign 0.03
R4669:Olfr146 UTSW 9 39019379 missense probably benign 0.10
R4788:Olfr146 UTSW 9 39018921 missense probably benign 0.07
R5184:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R5581:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6626:Olfr146 UTSW 9 39019106 missense possibly damaging 0.63
R6693:Olfr146 UTSW 9 39018801 missense probably damaging 0.98
R7165:Olfr146 UTSW 9 39023270 start gained probably benign
R7947:Olfr146 UTSW 9 39019451 missense probably damaging 0.99
R7957:Olfr146 UTSW 9 39019053 missense probably benign
R8052:Olfr146 UTSW 9 39019487 missense probably damaging 0.99
R8162:Olfr146 UTSW 9 39018953 missense probably benign 0.01
R9004:Olfr146 UTSW 9 39019284 missense probably benign 0.01
R9083:Olfr146 UTSW 9 39018720 missense probably damaging 1.00
R9584:Olfr146 UTSW 9 39019166 missense probably damaging 1.00
Z1088:Olfr146 UTSW 9 39018789 missense probably damaging 1.00
Z1191:Olfr146 UTSW 9 39018933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGTAGATTGGCAGAAGTC -3'
(R):5'- CTTCAAAGGTTTGATATGGTGAAGC -3'

Sequencing Primer
(F):5'- TCAATGAAGGACAGACTACTGAG -3'
(R):5'- GTGGTACCTGCTTCCAAA -3'
Posted On 2018-04-02