Incidental Mutation 'R6319:Grik4'
ID509343
Institutional Source Beutler Lab
Gene Symbol Grik4
Ensembl Gene ENSMUSG00000032017
Gene Nameglutamate receptor, ionotropic, kainate 4
Synonyms6330551K01Rik, GluRgamma1, KA-1, KA1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R6319 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location42518135-42944493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42566336 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 518 (M518K)
Ref Sequence ENSEMBL: ENSMUSP00000110515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034515] [ENSMUST00000114865]
Predicted Effect probably damaging
Transcript: ENSMUST00000034515
AA Change: M518K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034515
Gene: ENSMUSG00000032017
AA Change: M518K

DomainStartEndE-ValueType
Pfam:ANF_receptor 41 382 2.7e-60 PFAM
PBPe 417 786 1.88e-132 SMART
Lig_chan-Glu_bd 427 491 5.91e-31 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114865
AA Change: M518K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110515
Gene: ENSMUSG00000032017
AA Change: M518K

DomainStartEndE-ValueType
Pfam:ANF_receptor 41 382 5.1e-66 PFAM
PBPe 417 786 1.88e-132 SMART
Lig_chan-Glu_bd 427 491 5.91e-31 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
Meta Mutation Damage Score 0.6501 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced GYKI-resistant excitatory postsynaptic current. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,685,401 R233C probably benign Het
Abcg2 T C 6: 58,674,738 S372P probably benign Het
Adam34 A G 8: 43,651,915 I231T probably benign Het
Adgrg6 T A 10: 14,431,622 H840L probably damaging Het
Akap11 T C 14: 78,513,538 T470A probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B430306N03Rik A T 17: 48,316,743 Q24L probably damaging Het
Bmp6 A T 13: 38,346,414 H161L probably benign Het
Cdca8 C A 4: 124,921,294 D177Y possibly damaging Het
Col14a1 A G 15: 55,516,169 T1693A probably damaging Het
Cpsf1 A G 15: 76,596,967 S1230P probably damaging Het
Dcaf13 A G 15: 39,143,672 T334A probably benign Het
Dhx32 A C 7: 133,737,226 V360G probably damaging Het
Dmxl1 A G 18: 49,852,300 T205A probably benign Het
Dxo A G 17: 34,838,391 E253G probably damaging Het
Enpp1 T C 10: 24,648,031 Y747C probably damaging Het
Gga2 T C 7: 122,002,166 E238G possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Igf2r T A 17: 12,714,113 S841C probably damaging Het
Itfg1 G T 8: 85,840,629 T37K probably damaging Het
Kcnn4 T A 7: 24,381,740 M301K possibly damaging Het
Kel C A 6: 41,702,447 E127D probably benign Het
Lrp4 A G 2: 91,480,321 Y569C probably damaging Het
Lrp6 A T 6: 134,541,835 V89D possibly damaging Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Mnd1 A G 3: 84,141,764 S2P possibly damaging Het
Neb T A 2: 52,163,011 probably null Het
Olfr146 A G 9: 39,019,514 V9A probably damaging Het
Olfr191 A G 16: 59,086,021 I154T probably benign Het
Olfr609 T C 7: 103,492,725 E51G possibly damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Plekhm3 A T 1: 64,921,934 Y388N probably benign Het
Prr18 G T 17: 8,341,311 V100F probably damaging Het
Rnf25 T C 1: 74,595,731 Y44C probably damaging Het
Smg6 T C 11: 75,156,222 L1247P probably damaging Het
Tdh T C 14: 63,495,737 T137A probably benign Het
Tmem200a A G 10: 25,993,495 V292A probably damaging Het
Ubr3 T C 2: 69,973,414 V1116A probably benign Het
Ubr4 G A 4: 139,408,889 E942K possibly damaging Het
Unc5b G A 10: 60,778,801 A239V probably damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Vmn2r115 A G 17: 23,347,903 E463G possibly damaging Het
Other mutations in Grik4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Grik4 APN 9 42521176 missense probably damaging 0.99
IGL01929:Grik4 APN 9 42566298 critical splice donor site probably null
IGL02049:Grik4 APN 9 42543753 splice site probably benign
IGL02331:Grik4 APN 9 42541988 missense probably damaging 1.00
IGL02652:Grik4 APN 9 42675277 missense possibly damaging 0.94
IGL02817:Grik4 APN 9 42622939 missense probably benign 0.00
IGL02945:Grik4 APN 9 42597879 missense possibly damaging 0.92
IGL03100:Grik4 APN 9 42550455 missense probably damaging 0.99
IGL03168:Grik4 APN 9 42671243 missense probably damaging 1.00
R0420:Grik4 UTSW 9 42622096 nonsense probably null
R0894:Grik4 UTSW 9 42688109 splice site probably benign
R1458:Grik4 UTSW 9 42521122 missense probably benign 0.21
R1502:Grik4 UTSW 9 42520873 missense probably damaging 0.97
R1502:Grik4 UTSW 9 42591447 missense probably benign 0.03
R1808:Grik4 UTSW 9 42629026 missense probably benign 0.19
R1945:Grik4 UTSW 9 42521004 missense possibly damaging 0.79
R2180:Grik4 UTSW 9 42542005 missense probably benign 0.45
R2203:Grik4 UTSW 9 42547655 missense probably damaging 1.00
R2336:Grik4 UTSW 9 42566355 missense probably damaging 1.00
R2508:Grik4 UTSW 9 42622142 missense probably damaging 1.00
R2890:Grik4 UTSW 9 42671219 missense probably damaging 1.00
R3702:Grik4 UTSW 9 42675218 missense probably damaging 0.97
R3834:Grik4 UTSW 9 42629123 missense probably benign 0.04
R4082:Grik4 UTSW 9 42597884 missense probably benign 0.00
R4604:Grik4 UTSW 9 42524586 missense probably damaging 1.00
R4711:Grik4 UTSW 9 42629093 missense probably damaging 1.00
R5417:Grik4 UTSW 9 42671248 missense probably benign 0.45
R5540:Grik4 UTSW 9 42520947 missense probably damaging 0.99
R5680:Grik4 UTSW 9 42629119 missense probably benign
R5740:Grik4 UTSW 9 42808567 missense possibly damaging 0.88
R5876:Grik4 UTSW 9 42688023 missense probably damaging 1.00
R5911:Grik4 UTSW 9 42591424 missense probably damaging 1.00
R6475:Grik4 UTSW 9 42629008 missense probably benign 0.01
R6544:Grik4 UTSW 9 42547728 nonsense probably null
R7065:Grik4 UTSW 9 42543831 missense probably damaging 1.00
R7278:Grik4 UTSW 9 42622060 missense probably benign 0.25
R7605:Grik4 UTSW 9 42688071 missense probably damaging 1.00
X0028:Grik4 UTSW 9 42675227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCCTGCAGCTGATGGAAG -3'
(R):5'- CACATGGGTCCTTCTGAGAG -3'

Sequencing Primer
(F):5'- CATGTAACTCGGTGTTTGC -3'
(R):5'- TGGTTTAGATCCTGATAGAGCCAAG -3'
Posted On2018-04-02