Incidental Mutation 'R6319:Enpp1'
ID509346
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 1
SynonymsPC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R6319 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24637914-24712159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24648031 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 747 (Y747C)
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105520
AA Change: Y746C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: Y746C

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135846
AA Change: Y747C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: Y747C

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Meta Mutation Damage Score 0.5309 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,685,401 R233C probably benign Het
Abcg2 T C 6: 58,674,738 S372P probably benign Het
Adam34 A G 8: 43,651,915 I231T probably benign Het
Adgrg6 T A 10: 14,431,622 H840L probably damaging Het
Akap11 T C 14: 78,513,538 T470A probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B430306N03Rik A T 17: 48,316,743 Q24L probably damaging Het
Bmp6 A T 13: 38,346,414 H161L probably benign Het
Cdca8 C A 4: 124,921,294 D177Y possibly damaging Het
Col14a1 A G 15: 55,516,169 T1693A probably damaging Het
Cpsf1 A G 15: 76,596,967 S1230P probably damaging Het
Dcaf13 A G 15: 39,143,672 T334A probably benign Het
Dhx32 A C 7: 133,737,226 V360G probably damaging Het
Dmxl1 A G 18: 49,852,300 T205A probably benign Het
Dxo A G 17: 34,838,391 E253G probably damaging Het
Gga2 T C 7: 122,002,166 E238G possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Grik4 A T 9: 42,566,336 M518K probably damaging Het
Igf2r T A 17: 12,714,113 S841C probably damaging Het
Itfg1 G T 8: 85,840,629 T37K probably damaging Het
Kcnn4 T A 7: 24,381,740 M301K possibly damaging Het
Kel C A 6: 41,702,447 E127D probably benign Het
Lrp4 A G 2: 91,480,321 Y569C probably damaging Het
Lrp6 A T 6: 134,541,835 V89D possibly damaging Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Mnd1 A G 3: 84,141,764 S2P possibly damaging Het
Neb T A 2: 52,163,011 probably null Het
Olfr146 A G 9: 39,019,514 V9A probably damaging Het
Olfr191 A G 16: 59,086,021 I154T probably benign Het
Olfr609 T C 7: 103,492,725 E51G possibly damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Plekhm3 A T 1: 64,921,934 Y388N probably benign Het
Prr18 G T 17: 8,341,311 V100F probably damaging Het
Rnf25 T C 1: 74,595,731 Y44C probably damaging Het
Smg6 T C 11: 75,156,222 L1247P probably damaging Het
Tdh T C 14: 63,495,737 T137A probably benign Het
Tmem200a A G 10: 25,993,495 V292A probably damaging Het
Ubr3 T C 2: 69,973,414 V1116A probably benign Het
Ubr4 G A 4: 139,408,889 E942K possibly damaging Het
Unc5b G A 10: 60,778,801 A239V probably damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Vmn2r115 A G 17: 23,347,903 E463G possibly damaging Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24645427 missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24654031 missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24664614 missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24655856 missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24641961 missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24679185 splice site probably benign
IGL02691:Enpp1 APN 10 24711892 missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24660274 missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24655881 splice site probably benign
IGL03330:Enpp1 APN 10 24664906 splice site probably benign
IGL03365:Enpp1 APN 10 24669025 missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24660283 critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24653950 missense probably benign 0.16
R0011:Enpp1 UTSW 10 24670002 nonsense probably null
R0201:Enpp1 UTSW 10 24653917 missense probably benign 0.00
R0496:Enpp1 UTSW 10 24672052 missense probably benign 0.18
R1228:Enpp1 UTSW 10 24645412 missense probably benign 0.30
R1536:Enpp1 UTSW 10 24641834 missense probably benign 0.27
R1927:Enpp1 UTSW 10 24654888 missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24711804 critical splice donor site probably null
R2057:Enpp1 UTSW 10 24660192 missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24651341 missense probably benign 0.24
R4077:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4079:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4739:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4740:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4761:Enpp1 UTSW 10 24641951 missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24661935 missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24648085 missense probably benign 0.01
R5140:Enpp1 UTSW 10 24652852 missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24651390 missense probably benign
R5421:Enpp1 UTSW 10 24669757 missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24654908 missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24654919 missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24647239 missense probably benign
R5942:Enpp1 UTSW 10 24676068 nonsense probably null
R6048:Enpp1 UTSW 10 24660254 missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24657126 missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24641882 missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24669755 nonsense probably null
R6793:Enpp1 UTSW 10 24655825 missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24651339 missense probably benign 0.30
R7255:Enpp1 UTSW 10 24645315 missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24660161 missense probably benign 0.01
R7401:Enpp1 UTSW 10 24645282 missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7430:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7526:Enpp1 UTSW 10 24674410 intron probably null
R7532:Enpp1 UTSW 10 24675987 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACTCATAGCTGAATTTGTCCTCTG -3'
(R):5'- TACGTTTCCTGTCTGCGAGG -3'

Sequencing Primer
(F):5'- TTGTCCTCTGAAAATATACATGTGTC -3'
(R):5'- CAGGTTTTACAGGATTCAGTTGACTC -3'
Posted On2018-04-02