Incidental Mutation 'R6319:Unc5b'
ID509348
Institutional Source Beutler Lab
Gene Symbol Unc5b
Ensembl Gene ENSMUSG00000020099
Gene Nameunc-5 netrin receptor B
SynonymsUnc5h2, D10Bwg0792e, 6330415E02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6319 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location60762593-60831581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60778801 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 239 (A239V)
Ref Sequence ENSEMBL: ENSMUSP00000151251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077925] [ENSMUST00000218637]
Predicted Effect probably damaging
Transcript: ENSMUST00000077925
AA Change: A239V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077080
Gene: ENSMUSG00000020099
AA Change: A239V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG_like 54 149 1.71e2 SMART
IGc2 165 232 2.58e-6 SMART
TSP1 249 300 8.21e-15 SMART
TSP1 305 354 2.61e-8 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
ZU5 541 644 1.91e-56 SMART
DEATH 852 943 5.55e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218316
Predicted Effect probably damaging
Transcript: ENSMUST00000218637
AA Change: A239V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2055 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of receptors. This particular protein mediates the repulsive effect of netrin-1 and is a vascular netrin receptor. This encoded protein is also in a group of proteins called dependence receptors (DpRs) which are involved in pro- and anti-apoptotic processes. Many DpRs are involved in embryogenesis and in cancer progression. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a severely hypomorphic allele exhibit background sensitive lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,685,401 R233C probably benign Het
Abcg2 T C 6: 58,674,738 S372P probably benign Het
Adam34 A G 8: 43,651,915 I231T probably benign Het
Adgrg6 T A 10: 14,431,622 H840L probably damaging Het
Akap11 T C 14: 78,513,538 T470A probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B430306N03Rik A T 17: 48,316,743 Q24L probably damaging Het
Bmp6 A T 13: 38,346,414 H161L probably benign Het
Cdca8 C A 4: 124,921,294 D177Y possibly damaging Het
Col14a1 A G 15: 55,516,169 T1693A probably damaging Het
Cpsf1 A G 15: 76,596,967 S1230P probably damaging Het
Dcaf13 A G 15: 39,143,672 T334A probably benign Het
Dhx32 A C 7: 133,737,226 V360G probably damaging Het
Dmxl1 A G 18: 49,852,300 T205A probably benign Het
Dxo A G 17: 34,838,391 E253G probably damaging Het
Enpp1 T C 10: 24,648,031 Y747C probably damaging Het
Gga2 T C 7: 122,002,166 E238G possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Grik4 A T 9: 42,566,336 M518K probably damaging Het
Igf2r T A 17: 12,714,113 S841C probably damaging Het
Itfg1 G T 8: 85,840,629 T37K probably damaging Het
Kcnn4 T A 7: 24,381,740 M301K possibly damaging Het
Kel C A 6: 41,702,447 E127D probably benign Het
Lrp4 A G 2: 91,480,321 Y569C probably damaging Het
Lrp6 A T 6: 134,541,835 V89D possibly damaging Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Mnd1 A G 3: 84,141,764 S2P possibly damaging Het
Neb T A 2: 52,163,011 probably null Het
Olfr146 A G 9: 39,019,514 V9A probably damaging Het
Olfr191 A G 16: 59,086,021 I154T probably benign Het
Olfr609 T C 7: 103,492,725 E51G possibly damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Plekhm3 A T 1: 64,921,934 Y388N probably benign Het
Prr18 G T 17: 8,341,311 V100F probably damaging Het
Rnf25 T C 1: 74,595,731 Y44C probably damaging Het
Smg6 T C 11: 75,156,222 L1247P probably damaging Het
Tdh T C 14: 63,495,737 T137A probably benign Het
Tmem200a A G 10: 25,993,495 V292A probably damaging Het
Ubr3 T C 2: 69,973,414 V1116A probably benign Het
Ubr4 G A 4: 139,408,889 E942K possibly damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Vmn2r115 A G 17: 23,347,903 E463G possibly damaging Het
Other mutations in Unc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Unc5b APN 10 60783216 missense possibly damaging 0.73
IGL00578:Unc5b APN 10 60767055 missense probably damaging 1.00
IGL01895:Unc5b APN 10 60767085 missense probably damaging 1.00
IGL01955:Unc5b APN 10 60778255 missense probably benign 0.30
IGL01980:Unc5b APN 10 60780187 missense probably damaging 1.00
IGL02277:Unc5b APN 10 60774742 missense probably benign
LCD18:Unc5b UTSW 10 60786171 intron probably benign
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0026:Unc5b UTSW 10 60774592 missense possibly damaging 0.86
R0147:Unc5b UTSW 10 60772297 missense probably damaging 0.96
R0305:Unc5b UTSW 10 60779658 splice site probably benign
R0306:Unc5b UTSW 10 60779658 splice site probably benign
R0373:Unc5b UTSW 10 60778940 missense possibly damaging 0.78
R0662:Unc5b UTSW 10 60772583 missense possibly damaging 0.68
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1512:Unc5b UTSW 10 60831475 unclassified probably benign
R1532:Unc5b UTSW 10 60769232 missense probably damaging 0.99
R1916:Unc5b UTSW 10 60778248 missense probably damaging 1.00
R1931:Unc5b UTSW 10 60772569 missense probably benign 0.30
R1954:Unc5b UTSW 10 60769265 splice site probably benign
R2350:Unc5b UTSW 10 60778200 missense probably benign 0.04
R3419:Unc5b UTSW 10 60778814 missense probably damaging 1.00
R4116:Unc5b UTSW 10 60774700 missense probably damaging 0.99
R4258:Unc5b UTSW 10 60765371 missense probably damaging 0.99
R4329:Unc5b UTSW 10 60783190 missense probably damaging 1.00
R4605:Unc5b UTSW 10 60774403 missense probably benign 0.01
R4828:Unc5b UTSW 10 60772348 missense possibly damaging 0.90
R5134:Unc5b UTSW 10 60775100 missense probably benign 0.09
R5190:Unc5b UTSW 10 60772293 missense probably benign 0.04
R5240:Unc5b UTSW 10 60774640 missense probably damaging 0.99
R5342:Unc5b UTSW 10 60778267 nonsense probably null
R5522:Unc5b UTSW 10 60778195 missense possibly damaging 0.91
R5694:Unc5b UTSW 10 60773747 missense probably benign 0.02
R5822:Unc5b UTSW 10 60772527 missense possibly damaging 0.71
R5909:Unc5b UTSW 10 60772359 missense probably damaging 1.00
R6007:Unc5b UTSW 10 60765360 missense probably damaging 1.00
R6115:Unc5b UTSW 10 60777546 missense probably benign 0.33
R6182:Unc5b UTSW 10 60765236 missense probably damaging 1.00
R6187:Unc5b UTSW 10 60772224 missense probably damaging 1.00
R6294:Unc5b UTSW 10 60778331 missense possibly damaging 0.82
R6366:Unc5b UTSW 10 60778312 missense probably benign
R6532:Unc5b UTSW 10 60778828 missense possibly damaging 0.95
R6827:Unc5b UTSW 10 60780232 missense probably benign
R6912:Unc5b UTSW 10 60831092 missense probably benign
R7032:Unc5b UTSW 10 60778808 missense probably damaging 0.99
R7082:Unc5b UTSW 10 60775088 missense probably damaging 0.98
R7089:Unc5b UTSW 10 60777486 missense probably damaging 1.00
R7270:Unc5b UTSW 10 60772223 nonsense probably null
R7587:Unc5b UTSW 10 60783120 missense probably damaging 1.00
R7716:Unc5b UTSW 10 60777438 missense probably damaging 1.00
R7750:Unc5b UTSW 10 60775044 missense probably benign 0.00
R7810:Unc5b UTSW 10 60765241 missense probably benign
RF019:Unc5b UTSW 10 60783183 missense probably damaging 1.00
X0027:Unc5b UTSW 10 60777459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGTAACACCTAACCAGG -3'
(R):5'- TCCATCTTACAGTTGGCAGAC -3'

Sequencing Primer
(F):5'- GTCACCCAGAGTGTGGCTG -3'
(R):5'- CCATCTTACAGTTGGCAGACAATGAG -3'
Posted On2018-04-02