Incidental Mutation 'R6319:Bmp6'
ID509350
Institutional Source Beutler Lab
Gene Symbol Bmp6
Ensembl Gene ENSMUSG00000039004
Gene Namebone morphogenetic protein 6
SynonymsVgr1, D13Wsu115e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6319 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location38345107-38500302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38346414 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 161 (H161L)
Ref Sequence ENSEMBL: ENSMUSP00000126999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171970]
Predicted Effect probably benign
Transcript: ENSMUST00000171970
AA Change: H161L

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126999
Gene: ENSMUSG00000039004
AA Change: H161L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 56 359 2.3e-100 PFAM
low complexity region 368 389 N/A INTRINSIC
TGFB 409 510 6.8e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224452
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates a wide range of biological processes including iron homeostasis, fat and bone development, and ovulation. Mice lacking this gene exhibit delayed ossification of the sternum, iron overload, and reduced fertility in females. [provided by RefSeq, Jul 2016]
PHENOTYPE: One homozygous null mutant showed delayed ossification in the developing sternum while females of a second null mutant were smaller than normal in size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,685,401 R233C probably benign Het
Abcg2 T C 6: 58,674,738 S372P probably benign Het
Adam34 A G 8: 43,651,915 I231T probably benign Het
Adgrg6 T A 10: 14,431,622 H840L probably damaging Het
Akap11 T C 14: 78,513,538 T470A probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B430306N03Rik A T 17: 48,316,743 Q24L probably damaging Het
Cdca8 C A 4: 124,921,294 D177Y possibly damaging Het
Col14a1 A G 15: 55,516,169 T1693A probably damaging Het
Cpsf1 A G 15: 76,596,967 S1230P probably damaging Het
Dcaf13 A G 15: 39,143,672 T334A probably benign Het
Dhx32 A C 7: 133,737,226 V360G probably damaging Het
Dmxl1 A G 18: 49,852,300 T205A probably benign Het
Dxo A G 17: 34,838,391 E253G probably damaging Het
Enpp1 T C 10: 24,648,031 Y747C probably damaging Het
Gga2 T C 7: 122,002,166 E238G possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Grik4 A T 9: 42,566,336 M518K probably damaging Het
Igf2r T A 17: 12,714,113 S841C probably damaging Het
Itfg1 G T 8: 85,840,629 T37K probably damaging Het
Kcnn4 T A 7: 24,381,740 M301K possibly damaging Het
Kel C A 6: 41,702,447 E127D probably benign Het
Lrp4 A G 2: 91,480,321 Y569C probably damaging Het
Lrp6 A T 6: 134,541,835 V89D possibly damaging Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Mnd1 A G 3: 84,141,764 S2P possibly damaging Het
Neb T A 2: 52,163,011 probably null Het
Olfr146 A G 9: 39,019,514 V9A probably damaging Het
Olfr191 A G 16: 59,086,021 I154T probably benign Het
Olfr609 T C 7: 103,492,725 E51G possibly damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Plekhm3 A T 1: 64,921,934 Y388N probably benign Het
Prr18 G T 17: 8,341,311 V100F probably damaging Het
Rnf25 T C 1: 74,595,731 Y44C probably damaging Het
Smg6 T C 11: 75,156,222 L1247P probably damaging Het
Tdh T C 14: 63,495,737 T137A probably benign Het
Tmem200a A G 10: 25,993,495 V292A probably damaging Het
Ubr3 T C 2: 69,973,414 V1116A probably benign Het
Ubr4 G A 4: 139,408,889 E942K possibly damaging Het
Unc5b G A 10: 60,778,801 A239V probably damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Vmn2r115 A G 17: 23,347,903 E463G possibly damaging Het
Other mutations in Bmp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Bmp6 APN 13 38469634 missense probably damaging 0.99
IGL01409:Bmp6 APN 13 38485889 missense probably damaging 1.00
IGL01646:Bmp6 APN 13 38498928 missense probably damaging 0.99
IGL01823:Bmp6 APN 13 38498822 missense probably damaging 1.00
IGL03000:Bmp6 APN 13 38498911 splice site probably benign
IGL03337:Bmp6 APN 13 38498943 missense probably damaging 1.00
PIT4431001:Bmp6 UTSW 13 38485930 missense probably benign
R1218:Bmp6 UTSW 13 38346250 small deletion probably benign
R1225:Bmp6 UTSW 13 38346281 missense probably benign
R4579:Bmp6 UTSW 13 38469725 missense probably damaging 1.00
R4834:Bmp6 UTSW 13 38485841 missense probably damaging 1.00
R5208:Bmp6 UTSW 13 38469697 missense probably benign 0.23
R5713:Bmp6 UTSW 13 38498952 missense probably damaging 1.00
R5842:Bmp6 UTSW 13 38346567 missense probably damaging 0.99
R7348:Bmp6 UTSW 13 38485903 missense probably benign 0.00
R7565:Bmp6 UTSW 13 38346257 nonsense probably null
R7669:Bmp6 UTSW 13 38484920 missense probably damaging 0.98
R7681:Bmp6 UTSW 13 38346195 missense probably damaging 1.00
R7834:Bmp6 UTSW 13 38469667 missense probably damaging 1.00
R7917:Bmp6 UTSW 13 38469667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGATCCTGTCGGTGCTG -3'
(R):5'- GGTTCACAAAGCTCATGACC -3'

Sequencing Primer
(F):5'- TGCACGGTCTCCAGCAG -3'
(R):5'- GGTTCACAAAGCTCATGACCATGTC -3'
Posted On2018-04-02