Incidental Mutation 'R6319:Dcaf13'
ID509354
Institutional Source Beutler Lab
Gene Symbol Dcaf13
Ensembl Gene ENSMUSG00000022300
Gene NameDDB1 and CUL4 associated factor 13
SynonymsLOC223499, Wdsof1
MMRRC Submission
Accession Numbers

Genbank: NM_198606; MGI: 2684929

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6319 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location39112865-39146856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39143672 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 334 (T334A)
Ref Sequence ENSEMBL: ENSMUSP00000022909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022909]
Predicted Effect probably benign
Transcript: ENSMUST00000022909
AA Change: T334A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022909
Gene: ENSMUSG00000022300
AA Change: T334A

DomainStartEndE-ValueType
WD40 55 95 5.77e-5 SMART
WD40 98 137 4.38e-5 SMART
WD40 185 225 5.97e-1 SMART
Blast:WD40 228 267 1e-18 BLAST
WD40 271 310 2.69e-5 SMART
WD40 312 353 2.96e-2 SMART
Pfam:Sof1 354 440 7.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227219
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,685,401 R233C probably benign Het
Abcg2 T C 6: 58,674,738 S372P probably benign Het
Adam34 A G 8: 43,651,915 I231T probably benign Het
Adgrg6 T A 10: 14,431,622 H840L probably damaging Het
Akap11 T C 14: 78,513,538 T470A probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B430306N03Rik A T 17: 48,316,743 Q24L probably damaging Het
Bmp6 A T 13: 38,346,414 H161L probably benign Het
Cdca8 C A 4: 124,921,294 D177Y possibly damaging Het
Col14a1 A G 15: 55,516,169 T1693A probably damaging Het
Cpsf1 A G 15: 76,596,967 S1230P probably damaging Het
Dhx32 A C 7: 133,737,226 V360G probably damaging Het
Dmxl1 A G 18: 49,852,300 T205A probably benign Het
Dxo A G 17: 34,838,391 E253G probably damaging Het
Enpp1 T C 10: 24,648,031 Y747C probably damaging Het
Gga2 T C 7: 122,002,166 E238G possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Grik4 A T 9: 42,566,336 M518K probably damaging Het
Igf2r T A 17: 12,714,113 S841C probably damaging Het
Itfg1 G T 8: 85,840,629 T37K probably damaging Het
Kcnn4 T A 7: 24,381,740 M301K possibly damaging Het
Kel C A 6: 41,702,447 E127D probably benign Het
Lrp4 A G 2: 91,480,321 Y569C probably damaging Het
Lrp6 A T 6: 134,541,835 V89D possibly damaging Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Mnd1 A G 3: 84,141,764 S2P possibly damaging Het
Neb T A 2: 52,163,011 probably null Het
Olfr146 A G 9: 39,019,514 V9A probably damaging Het
Olfr191 A G 16: 59,086,021 I154T probably benign Het
Olfr609 T C 7: 103,492,725 E51G possibly damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Plekhm3 A T 1: 64,921,934 Y388N probably benign Het
Prr18 G T 17: 8,341,311 V100F probably damaging Het
Rnf25 T C 1: 74,595,731 Y44C probably damaging Het
Smg6 T C 11: 75,156,222 L1247P probably damaging Het
Tdh T C 14: 63,495,737 T137A probably benign Het
Tmem200a A G 10: 25,993,495 V292A probably damaging Het
Ubr3 T C 2: 69,973,414 V1116A probably benign Het
Ubr4 G A 4: 139,408,889 E942K possibly damaging Het
Unc5b G A 10: 60,778,801 A239V probably damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Vmn2r115 A G 17: 23,347,903 E463G possibly damaging Het
Other mutations in Dcaf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Dcaf13 APN 15 39143632 nonsense probably null
IGL01081:Dcaf13 APN 15 39118806 missense probably damaging 1.00
IGL01766:Dcaf13 APN 15 39118750 missense probably benign 0.00
IGL02174:Dcaf13 APN 15 39138149 missense probably damaging 1.00
IGL02262:Dcaf13 APN 15 39118707 splice site probably benign
IGL02740:Dcaf13 APN 15 39145100 nonsense probably null
IGL03092:Dcaf13 APN 15 39127976 splice site probably benign
IGL03374:Dcaf13 APN 15 39145148 nonsense probably null
R0590:Dcaf13 UTSW 15 39145085 splice site probably benign
R0594:Dcaf13 UTSW 15 39123268 missense probably benign 0.00
R0711:Dcaf13 UTSW 15 39138089 missense probably damaging 1.00
R1036:Dcaf13 UTSW 15 39143718 missense probably damaging 1.00
R1770:Dcaf13 UTSW 15 39130238 missense probably damaging 1.00
R1826:Dcaf13 UTSW 15 39118899 missense probably damaging 1.00
R1933:Dcaf13 UTSW 15 39138088 missense probably damaging 0.99
R2508:Dcaf13 UTSW 15 39145152 missense probably benign
R4113:Dcaf13 UTSW 15 39130220 missense probably damaging 0.98
R4595:Dcaf13 UTSW 15 39118893 missense probably damaging 1.00
R4649:Dcaf13 UTSW 15 39138242 missense possibly damaging 0.54
R5431:Dcaf13 UTSW 15 39123224 missense probably benign 0.16
R5454:Dcaf13 UTSW 15 39124364 missense probably benign
R5834:Dcaf13 UTSW 15 39143642 nonsense probably null
R5929:Dcaf13 UTSW 15 39143653 missense possibly damaging 0.89
R5944:Dcaf13 UTSW 15 39146677 missense probably benign
R6394:Dcaf13 UTSW 15 39143737 missense probably benign 0.04
R6664:Dcaf13 UTSW 15 39118888 missense probably damaging 1.00
R6884:Dcaf13 UTSW 15 39123240 missense probably damaging 1.00
R7419:Dcaf13 UTSW 15 39130220 missense probably damaging 0.98
Z1088:Dcaf13 UTSW 15 39145247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTCTGTTAGGCCATCTGTCTG -3'
(R):5'- CCATCACAATGGTGTTACCCTG -3'

Sequencing Primer
(F):5'- TTCCCAAGCACTTAGACTAGAAC -3'
(R):5'- CACAATGGTGTTACCCTGATTAAG -3'
Posted On2018-04-02