Mutagenetix > Incidental Mutations

Incidental Mutation 'R6319:Col14a1'

509355

Institutional Source

Beutler Lab

Gene Symbol

Col14a1

Ensembl Gene

ENSMUSG00000022371

Gene Name

collagen, type XIV, alpha 1

Synonyms

5730412L22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6319 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55307750-55520803 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55516169 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1693 (T1693A)

Ref Sequence

ENSEMBL: ENSMUSP00000105850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023053
AA Change: T1696A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: T1696A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FN3	30	108	5.4e-7	SMART
low complexity region	122	136	N/A	INTRINSIC
VWA	157	336	9.5e-56	SMART
FN3	354	434	3.82e-7	SMART
FN3	444	522	3.1e-7	SMART
FN3	536	613	5.07e-12	SMART
FN3	625	704	3.1e-7	SMART
FN3	736	818	6.2e-7	SMART
FN3	830	909	1.45e-7	SMART
FN3	920	999	3.59e0	SMART
low complexity region	1010	1022	N/A	INTRINSIC
VWA	1031	1211	2.02e-59	SMART
TSPN	1230	1425	1.19e-66	SMART
Pfam:Collagen	1461	1515	2.9e-8	PFAM
Pfam:Collagen	1513	1571	6.3e-9	PFAM
Pfam:Collagen	1555	1615	8.5e-10	PFAM
Pfam:Collagen	1653	1709	7.6e-10	PFAM
Pfam:Collagen	1707	1762	2.6e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110217
AA Change: T1697A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: T1697A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FN3	30	108	5.4e-7	SMART
low complexity region	122	136	N/A	INTRINSIC
VWA	157	336	9.5e-56	SMART
FN3	354	434	3.82e-7	SMART
FN3	444	522	3.1e-7	SMART
FN3	536	613	5.07e-12	SMART
FN3	625	704	3.1e-7	SMART
FN3	736	819	5.4e-7	SMART
FN3	831	910	1.45e-7	SMART
FN3	921	1000	3.59e0	SMART
low complexity region	1011	1023	N/A	INTRINSIC
VWA	1032	1212	2.02e-59	SMART
TSPN	1231	1426	1.19e-66	SMART
Pfam:Collagen	1462	1516	2.5e-8	PFAM
Pfam:Collagen	1514	1572	5.4e-9	PFAM
Pfam:Collagen	1556	1616	7.3e-10	PFAM
Pfam:Collagen	1654	1710	6.5e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110221
AA Change: T1693A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: T1693A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FN3	30	108	5.4e-7	SMART
low complexity region	122	136	N/A	INTRINSIC
VWA	157	336	9.5e-56	SMART
FN3	354	434	3.82e-7	SMART
FN3	444	522	3.1e-7	SMART
FN3	536	613	5.07e-12	SMART
FN3	625	704	3.1e-7	SMART
FN3	736	815	7.12e-7	SMART
FN3	827	906	1.45e-7	SMART
FN3	917	996	3.59e0	SMART
low complexity region	1007	1019	N/A	INTRINSIC
VWA	1028	1208	2.02e-59	SMART
TSPN	1227	1422	1.19e-66	SMART
Pfam:Collagen	1458	1512	8.2e-9	PFAM
Pfam:Collagen	1510	1568	1.8e-9	PFAM
Pfam:Collagen	1552	1612	2.4e-10	PFAM
Pfam:Collagen	1650	1706	2.2e-10	PFAM
Pfam:Collagen	1704	1759	7.5e-8	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000125416
AA Change: T435A

SMART Domains

Protein: ENSMUSP00000122455
Gene: ENSMUSG00000022371
AA Change: T435A

Domain	Start	End	E-Value	Type
TSPN	2	165	2.04e-42	SMART
Pfam:Collagen	201	255	2.1e-9	PFAM
Pfam:Collagen	253	305	3.3e-9	PFAM
Pfam:Collagen	295	355	4.4e-11	PFAM
Pfam:Collagen	393	448	5.7e-11	PFAM

Meta Mutation Damage Score

0.0630

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,685,401	R233C	probably benign	Het
Abcg2	T	C	6: 58,674,738	S372P	probably benign	Het
Adam34	A	G	8: 43,651,915	I231T	probably benign	Het
Adgrg6	T	A	10: 14,431,622	H840L	probably damaging	Het
Akap11	T	C	14: 78,513,538	T470A	probably benign	Het
Atp1a2	C	G	1: 172,289,336	R238P	probably damaging	Het
B430306N03Rik	A	T	17: 48,316,743	Q24L	probably damaging	Het
Bmp6	A	T	13: 38,346,414	H161L	probably benign	Het
Cdca8	C	A	4: 124,921,294	D177Y	possibly damaging	Het
Cpsf1	A	G	15: 76,596,967	S1230P	probably damaging	Het
Dcaf13	A	G	15: 39,143,672	T334A	probably benign	Het
Dhx32	A	C	7: 133,737,226	V360G	probably damaging	Het
Dmxl1	A	G	18: 49,852,300	T205A	probably benign	Het
Dxo	A	G	17: 34,838,391	E253G	probably damaging	Het
Enpp1	T	C	10: 24,648,031	Y747C	probably damaging	Het
Gga2	T	C	7: 122,002,166	E238G	possibly damaging	Het
Gpn3	C	T	5: 122,372,575		probably benign	Het
Grik4	A	T	9: 42,566,336	M518K	probably damaging	Het
Igf2r	T	A	17: 12,714,113	S841C	probably damaging	Het
Itfg1	G	T	8: 85,840,629	T37K	probably damaging	Het
Kcnn4	T	A	7: 24,381,740	M301K	possibly damaging	Het
Kel	C	A	6: 41,702,447	E127D	probably benign	Het
Lrp4	A	G	2: 91,480,321	Y569C	probably damaging	Het
Lrp6	A	T	6: 134,541,835	V89D	possibly damaging	Het
Mical2	A	G	7: 112,328,677	D674G	possibly damaging	Het
Mnd1	A	G	3: 84,141,764	S2P	possibly damaging	Het
Neb	T	A	2: 52,163,011		probably null	Het
Olfr146	A	G	9: 39,019,514	V9A	probably damaging	Het
Olfr191	A	G	16: 59,086,021	I154T	probably benign	Het
Olfr609	T	C	7: 103,492,725	E51G	possibly damaging	Het
Pcca	G	A	14: 122,582,623	V60M	probably damaging	Het
Plekhm3	A	T	1: 64,921,934	Y388N	probably benign	Het
Prr18	G	T	17: 8,341,311	V100F	probably damaging	Het
Rnf25	T	C	1: 74,595,731	Y44C	probably damaging	Het
Smg6	T	C	11: 75,156,222	L1247P	probably damaging	Het
Tdh	T	C	14: 63,495,737	T137A	probably benign	Het
Tmem200a	A	G	10: 25,993,495	V292A	probably damaging	Het
Ubr3	T	C	2: 69,973,414	V1116A	probably benign	Het
Ubr4	G	A	4: 139,408,889	E942K	possibly damaging	Het
Unc5b	G	A	10: 60,778,801	A239V	probably damaging	Het
Vill	G	C	9: 119,063,648	Q376H	probably benign	Het
Vmn2r115	A	G	17: 23,347,903	E463G	possibly damaging	Het

Other mutations in Col14a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00663:Col14a1	APN	15	55411585	missense	unknown
IGL01290:Col14a1	APN	15	55423507	missense	unknown
IGL01300:Col14a1	APN	15	55467976	missense	unknown
IGL01505:Col14a1	APN	15	55455223	missense	unknown
IGL01533:Col14a1	APN	15	55420840	missense	unknown
IGL01563:Col14a1	APN	15	55487941	missense	unknown
IGL01650:Col14a1	APN	15	55406693	missense	unknown
IGL01659:Col14a1	APN	15	55446172	unclassified	probably benign
IGL01670:Col14a1	APN	15	55329266	missense	unknown
IGL01760:Col14a1	APN	15	55423459	missense	unknown
IGL01803:Col14a1	APN	15	55418814	missense	unknown
IGL01966:Col14a1	APN	15	55448725	unclassified	probably benign
IGL01990:Col14a1	APN	15	55363463	missense	unknown
IGL02124:Col14a1	APN	15	55463703	missense	unknown
IGL02138:Col14a1	APN	15	55420835	missense	unknown
IGL02192:Col14a1	APN	15	55362402	missense	unknown
IGL02326:Col14a1	APN	15	55418797	missense	unknown
IGL02335:Col14a1	APN	15	55463769	splice site	probably benign
IGL02407:Col14a1	APN	15	55448876	splice site	probably benign
IGL02486:Col14a1	APN	15	55388696	splice site	probably benign
IGL02537:Col14a1	APN	15	55344914	nonsense	probably null
IGL02567:Col14a1	APN	15	55344961	critical splice donor site	probably null
IGL02643:Col14a1	APN	15	55420862	missense	unknown
IGL02669:Col14a1	APN	15	55418782	missense	unknown
IGL02673:Col14a1	APN	15	55418782	missense	unknown
IGL02674:Col14a1	APN	15	55418782	missense	unknown
IGL03201:Col14a1	APN	15	55408904	missense	unknown
IGL03334:Col14a1	APN	15	55448821	unclassified	probably benign
IGL03370:Col14a1	APN	15	55488541	splice site	probably null
IGL03385:Col14a1	APN	15	55410204	missense	unknown
IGL03385:Col14a1	APN	15	55471708	missense	unknown
PIT4131001:Col14a1	UTSW	15	55448876	splice site	probably benign
R0046:Col14a1	UTSW	15	55408963	splice site	probably benign
R0046:Col14a1	UTSW	15	55408963	splice site	probably benign
R0173:Col14a1	UTSW	15	55488532	missense	probably damaging	1.00
R0242:Col14a1	UTSW	15	55497511	missense	probably damaging	1.00
R0242:Col14a1	UTSW	15	55497511	missense	probably damaging	1.00
R0359:Col14a1	UTSW	15	55407868	splice site	probably benign
R0391:Col14a1	UTSW	15	55446259	unclassified	probably benign
R0468:Col14a1	UTSW	15	55388646	missense	unknown
R0652:Col14a1	UTSW	15	55344882	missense	unknown
R0692:Col14a1	UTSW	15	55341738	missense	unknown
R0745:Col14a1	UTSW	15	55338417	missense	unknown
R1006:Col14a1	UTSW	15	55519935	missense	probably benign	0.04
R1331:Col14a1	UTSW	15	55410188	missense	unknown
R1537:Col14a1	UTSW	15	55380767	missense	unknown
R1557:Col14a1	UTSW	15	55388579	missense	unknown
R1721:Col14a1	UTSW	15	55447462	unclassified	probably benign
R1737:Col14a1	UTSW	15	55344961	critical splice donor site	probably benign
R1837:Col14a1	UTSW	15	55382495	missense	unknown
R1867:Col14a1	UTSW	15	55447462	unclassified	probably benign
R1868:Col14a1	UTSW	15	55447462	unclassified	probably benign
R1991:Col14a1	UTSW	15	55449940	missense	unknown
R2020:Col14a1	UTSW	15	55446181	unclassified	probably benign
R2103:Col14a1	UTSW	15	55449940	missense	unknown
R2116:Col14a1	UTSW	15	55407764	missense	unknown
R2163:Col14a1	UTSW	15	55444645	unclassified	probably benign
R2207:Col14a1	UTSW	15	55463686	missense	unknown
R2215:Col14a1	UTSW	15	55380842	missense	unknown
R2264:Col14a1	UTSW	15	55466690	splice site	probably null
R2383:Col14a1	UTSW	15	55447517	unclassified	probably benign
R2397:Col14a1	UTSW	15	55338439	missense	unknown
R2422:Col14a1	UTSW	15	55449922	missense	unknown
R3793:Col14a1	UTSW	15	55363513	missense	unknown
R4082:Col14a1	UTSW	15	55437033	missense	unknown
R4112:Col14a1	UTSW	15	55363559	missense	unknown
R4519:Col14a1	UTSW	15	55388579	missense	unknown
R4628:Col14a1	UTSW	15	55449833	nonsense	probably null
R4692:Col14a1	UTSW	15	55423468	missense	unknown
R4696:Col14a1	UTSW	15	55372602	missense	unknown
R4749:Col14a1	UTSW	15	55452336	missense	unknown
R5324:Col14a1	UTSW	15	55338445	missense	unknown
R5382:Col14a1	UTSW	15	55362436	missense	unknown
R5634:Col14a1	UTSW	15	55518298	missense	probably damaging	1.00
R5781:Col14a1	UTSW	15	55423512	missense	unknown
R5828:Col14a1	UTSW	15	55436976	missense	unknown
R5873:Col14a1	UTSW	15	55445786	unclassified	probably benign
R5966:Col14a1	UTSW	15	55452383	critical splice donor site	probably null
R6106:Col14a1	UTSW	15	55520008	missense	probably damaging	1.00
R6135:Col14a1	UTSW	15	55380850	missense	unknown
R6475:Col14a1	UTSW	15	55445822	unclassified	probably benign
R6540:Col14a1	UTSW	15	55372581	missense	unknown
R6893:Col14a1	UTSW	15	55444648	unclassified	probably benign
R6992:Col14a1	UTSW	15	55411562	splice site	probably null
R7284:Col14a1	UTSW	15	55518319	missense	probably damaging	1.00
R7404:Col14a1	UTSW	15	55388628	nonsense	probably null
R7655:Col14a1	UTSW	15	55362450	missense	unknown
R7656:Col14a1	UTSW	15	55362450	missense	unknown
R7715:Col14a1	UTSW	15	55487983	missense	unknown
R7841:Col14a1	UTSW	15	55382480	missense	unknown
R7861:Col14a1	UTSW	15	55444616	missense	unknown
R7866:Col14a1	UTSW	15	55388620	missense	unknown
R7902:Col14a1	UTSW	15	55501436	missense	probably benign	0.16
R8041:Col14a1	UTSW	15	55455230	missense	unknown
R8159:Col14a1	UTSW	15	55427928	missense	unknown
R8224:Col14a1	UTSW	15	55407741	missense	unknown
R8282:Col14a1	UTSW	15	55420880	missense	unknown
X0023:Col14a1	UTSW	15	55423447	missense	unknown
X0063:Col14a1	UTSW	15	55410215	missense	unknown
Z1177:Col14a1	UTSW	15	55372570	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAATGTGACCACCTGTAATGTG -3'
(R):5'- TGCACTGGCCTTGCAATAAAATAC -3'

Sequencing Primer
(F):5'- TGACCACCTGTAATGTGATTTTG -3'
(R):5'- CTGGCCTTGCAATAAAATACATGAG -3'

Posted On

2018-04-02