Incidental Mutation 'R6329:Spta1'
ID509367
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Namespectrin alpha, erythrocytic 1
Synonymserythroid, Spna-1, ihj, Spna1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R6329 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location174172776-174248450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174214177 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1371 (I1371T)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027817
AA Change: I1371T

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: I1371T

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156092
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,173,696 H72R probably damaging Het
Abca13 A T 11: 9,277,937 N660I probably damaging Het
Actr8 C T 14: 29,993,084 R619* probably null Het
Adam18 C A 8: 24,614,827 G657V probably damaging Het
Adcyap1 A G 17: 93,202,799 E85G probably benign Het
Akr1c14 A G 13: 4,087,302 Y305C probably damaging Het
Ankdd1b T A 13: 96,454,880 H37L possibly damaging Het
Ap4e1 T C 2: 127,061,716 L846P probably benign Het
Aqp9 A T 9: 71,132,684 Y105* probably null Het
Arid1b C T 17: 5,337,263 Q1664* probably null Het
Aup1 A G 6: 83,054,607 probably benign Het
Bnip1 C A 17: 26,786,710 S64* probably null Het
Calcr T A 6: 3,687,621 Q422L probably damaging Het
Ccdc162 T A 10: 41,663,151 D407V possibly damaging Het
Ccdc66 G T 14: 27,486,484 S760R probably benign Het
Cd22 T A 7: 30,877,768 E38V probably damaging Het
Cggbp1 T C 16: 64,856,020 Y150H probably damaging Het
Chd3 T C 11: 69,361,684 K263R possibly damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a2 T C 10: 76,599,828 T858A probably benign Het
Dnah7a T A 1: 53,541,114 D1554V probably damaging Het
Dnajc25 A T 4: 59,013,678 Q132L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Ehbp1l1 A C 19: 5,718,767 I836S possibly damaging Het
Elf1 A G 14: 79,573,339 Q288R possibly damaging Het
Fbn1 C A 2: 125,308,473 V2608L possibly damaging Het
Frmpd1 T C 4: 45,268,551 I232T possibly damaging Het
Fuca1 T A 4: 135,934,826 I355N probably damaging Het
Gcnt4 A G 13: 96,947,273 D359G probably damaging Het
Gm15448 T C 7: 3,822,851 T340A probably damaging Het
Gm5134 T C 10: 75,954,660 M30T possibly damaging Het
Grk1 T G 8: 13,405,704 L196R probably damaging Het
Igkv14-126 A C 6: 67,896,564 D92A probably damaging Het
Kmt2c A G 5: 25,315,602 S1837P probably benign Het
Lhx4 T A 1: 155,702,554 T281S probably benign Het
Lrrc55 G T 2: 85,196,309 H124N probably benign Het
March8 T A 6: 116,406,316 I566N possibly damaging Het
Mycbp2 G A 14: 103,155,852 A3091V probably benign Het
Nlrp4b A G 7: 10,724,920 N355S probably benign Het
Nmur2 A G 11: 56,029,585 V278A probably benign Het
Nod1 T C 6: 54,944,704 M210V probably benign Het
Nt5c1b T A 12: 10,372,138 C63* probably null Het
Olfr1164 G A 2: 88,093,664 P91S probably damaging Het
Olfr1288 C T 2: 111,479,228 A148V possibly damaging Het
Olfr346 A T 2: 36,688,682 K227* probably null Het
Olfr397 A G 11: 73,964,742 I45V possibly damaging Het
Olfr836 A C 9: 19,120,957 M1L probably benign Het
Olfr884 T C 9: 38,047,825 V201A probably benign Het
Olfr938 C T 9: 39,077,903 V281I probably benign Het
Osbp2 T A 11: 3,715,153 S517C probably damaging Het
Pcdha1 C T 18: 36,932,248 P655L probably damaging Het
Pdcd6 A G 13: 74,303,979 Y181H probably damaging Het
Perp G A 10: 18,855,754 G154S probably damaging Het
Perp G T 10: 18,855,755 G154V probably damaging Het
Prokr1 T G 6: 87,581,792 T204P possibly damaging Het
Prpf3 A T 3: 95,832,578 C630S probably damaging Het
Pter C A 2: 12,980,548 H230N probably damaging Het
Ptprs A T 17: 56,417,427 Y1167* probably null Het
Rad54l2 T C 9: 106,717,922 I279V possibly damaging Het
Rora T A 9: 69,373,186 L347Q probably damaging Het
Runx1t1 T G 4: 13,785,136 M1R probably null Het
Sdcbp A G 4: 6,381,064 S70G probably benign Het
Serpinb12 A G 1: 106,953,763 Y210C probably damaging Het
Sipa1 T C 19: 5,651,489 E1015G probably damaging Het
Slc15a2 A C 16: 36,751,782 L740R possibly damaging Het
Specc1 A G 11: 62,156,553 E916G probably damaging Het
Tagln3 T C 16: 45,713,002 M130V probably benign Het
Tchh A T 3: 93,446,445 E1064V unknown Het
Tdp1 A T 12: 99,914,071 S464C probably damaging Het
Tdp1 G C 12: 99,914,072 S464T probably benign Het
Tenm3 T C 8: 48,276,849 Y1374C probably damaging Het
Tmprss3 A T 17: 31,183,859 Y455* probably null Het
Ttc5 A G 14: 50,765,928 V433A possibly damaging Het
Wnt5a A T 14: 28,518,492 R180* probably null Het
Zfp53 A G 17: 21,508,110 D135G probably benign Het
Zfp619 T A 7: 39,537,545 C1000S probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0208:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2187:Spta1 UTSW 1 174192966 missense probably damaging 1.00
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4673:Spta1 UTSW 1 174191062 splice site probably null
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 splice site probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6317:Spta1 UTSW 1 174241087 missense probably damaging 1.00
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 splice site probably null
R6533:Spta1 UTSW 1 174244147 missense probably damaging 1.00
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense probably damaging 0.98
R7087:Spta1 UTSW 1 174174510 missense probably benign
R7151:Spta1 UTSW 1 174197751 missense probably damaging 1.00
R7193:Spta1 UTSW 1 174184612 missense probably damaging 1.00
R7199:Spta1 UTSW 1 174223271 missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174222637 missense probably damaging 0.96
R7343:Spta1 UTSW 1 174223349 missense probably damaging 0.99
R7372:Spta1 UTSW 1 174197635 nonsense probably null
R7472:Spta1 UTSW 1 174246499 missense probably damaging 1.00
R7516:Spta1 UTSW 1 174197783 missense probably damaging 1.00
R7627:Spta1 UTSW 1 174205378 missense probably damaging 1.00
R7770:Spta1 UTSW 1 174195981 nonsense probably null
R7784:Spta1 UTSW 1 174202451 missense probably damaging 1.00
R7804:Spta1 UTSW 1 174195905 missense possibly damaging 0.50
R7854:Spta1 UTSW 1 174218830 critical splice donor site probably null
R7862:Spta1 UTSW 1 174197785 critical splice donor site probably null
R7958:Spta1 UTSW 1 174174390 missense probably benign 0.03
R8015:Spta1 UTSW 1 174240171 missense probably damaging 1.00
R8076:Spta1 UTSW 1 174187231 missense probably benign 0.00
R8152:Spta1 UTSW 1 174217944 missense probably benign 0.03
R8235:Spta1 UTSW 1 174202386 missense probably damaging 1.00
R8284:Spta1 UTSW 1 174179821 missense probably benign 0.00
R8298:Spta1 UTSW 1 174247387 missense probably damaging 1.00
R8312:Spta1 UTSW 1 174240211 missense probably damaging 1.00
RF002:Spta1 UTSW 1 174231360 missense possibly damaging 0.62
RF018:Spta1 UTSW 1 174209319 missense probably damaging 1.00
RF020:Spta1 UTSW 1 174213444 missense probably benign 0.42
RF020:Spta1 UTSW 1 174217903 missense probably damaging 1.00
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174191051 missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174240367 missense probably damaging 0.99
Z1177:Spta1 UTSW 1 174190162 missense probably benign 0.09
Z1177:Spta1 UTSW 1 174245689 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAGATCTTGCTGGAGCGAC -3'
(R):5'- CCTGCAGTTCTAAGCACTCAAG -3'

Sequencing Primer
(F):5'- ACTGGCCACTGATTTAAAACTCTC -3'
(R):5'- GTTCTAAGCACTCAAGTAACTAAGGC -3'
Posted On2018-04-02