Incidental Mutation 'R6329:Adam18'
ID509396
Institutional Source Beutler Lab
Gene Symbol Adam18
Ensembl Gene ENSMUSG00000031552
Gene Namea disintegrin and metallopeptidase domain 18
SynonymsAdam27, Dtgn3
Accession Numbers

Genbank: NM_010084

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6329 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location24602246-24674755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24614827 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 657 (G657V)
Ref Sequence ENSEMBL: ENSMUSP00000033957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033957] [ENSMUST00000138232] [ENSMUST00000173833]
Predicted Effect probably damaging
Transcript: ENSMUST00000033957
AA Change: G657V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033957
Gene: ENSMUSG00000031552
AA Change: G657V

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 1.7e-25 PFAM
Pfam:Reprolysin 180 377 1.1e-57 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138232
Predicted Effect probably benign
Transcript: ENSMUST00000173833
SMART Domains Protein: ENSMUSP00000133378
Gene: ENSMUSG00000031552

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 9.5e-35 PFAM
Pfam:Reprolysin 180 378 7.7e-56 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during early stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with that of controls. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,173,696 H72R probably damaging Het
Abca13 A T 11: 9,277,937 N660I probably damaging Het
Actr8 C T 14: 29,993,084 R619* probably null Het
Adcyap1 A G 17: 93,202,799 E85G probably benign Het
Akr1c14 A G 13: 4,087,302 Y305C probably damaging Het
Ankdd1b T A 13: 96,454,880 H37L possibly damaging Het
Ap4e1 T C 2: 127,061,716 L846P probably benign Het
Aqp9 A T 9: 71,132,684 Y105* probably null Het
Arid1b C T 17: 5,337,263 Q1664* probably null Het
Aup1 A G 6: 83,054,607 probably benign Het
Bnip1 C A 17: 26,786,710 S64* probably null Het
Calcr T A 6: 3,687,621 Q422L probably damaging Het
Ccdc162 T A 10: 41,663,151 D407V possibly damaging Het
Ccdc66 G T 14: 27,486,484 S760R probably benign Het
Cd22 T A 7: 30,877,768 E38V probably damaging Het
Cggbp1 T C 16: 64,856,020 Y150H probably damaging Het
Chd3 T C 11: 69,361,684 K263R possibly damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a2 T C 10: 76,599,828 T858A probably benign Het
Dnah7a T A 1: 53,541,114 D1554V probably damaging Het
Dnajc25 A T 4: 59,013,678 Q132L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Ehbp1l1 A C 19: 5,718,767 I836S possibly damaging Het
Elf1 A G 14: 79,573,339 Q288R possibly damaging Het
Fbn1 C A 2: 125,308,473 V2608L possibly damaging Het
Frmpd1 T C 4: 45,268,551 I232T possibly damaging Het
Fuca1 T A 4: 135,934,826 I355N probably damaging Het
Gcnt4 A G 13: 96,947,273 D359G probably damaging Het
Gm15448 T C 7: 3,822,851 T340A probably damaging Het
Gm5134 T C 10: 75,954,660 M30T possibly damaging Het
Grk1 T G 8: 13,405,704 L196R probably damaging Het
Igkv14-126 A C 6: 67,896,564 D92A probably damaging Het
Kmt2c A G 5: 25,315,602 S1837P probably benign Het
Lhx4 T A 1: 155,702,554 T281S probably benign Het
Lrrc55 G T 2: 85,196,309 H124N probably benign Het
March8 T A 6: 116,406,316 I566N possibly damaging Het
Mycbp2 G A 14: 103,155,852 A3091V probably benign Het
Nlrp4b A G 7: 10,724,920 N355S probably benign Het
Nmur2 A G 11: 56,029,585 V278A probably benign Het
Nod1 T C 6: 54,944,704 M210V probably benign Het
Nt5c1b T A 12: 10,372,138 C63* probably null Het
Olfr1164 G A 2: 88,093,664 P91S probably damaging Het
Olfr1288 C T 2: 111,479,228 A148V possibly damaging Het
Olfr346 A T 2: 36,688,682 K227* probably null Het
Olfr397 A G 11: 73,964,742 I45V possibly damaging Het
Olfr836 A C 9: 19,120,957 M1L probably benign Het
Olfr884 T C 9: 38,047,825 V201A probably benign Het
Olfr938 C T 9: 39,077,903 V281I probably benign Het
Osbp2 T A 11: 3,715,153 S517C probably damaging Het
Pcdha1 C T 18: 36,932,248 P655L probably damaging Het
Pdcd6 A G 13: 74,303,979 Y181H probably damaging Het
Perp G A 10: 18,855,754 G154S probably damaging Het
Perp G T 10: 18,855,755 G154V probably damaging Het
Prokr1 T G 6: 87,581,792 T204P possibly damaging Het
Prpf3 A T 3: 95,832,578 C630S probably damaging Het
Pter C A 2: 12,980,548 H230N probably damaging Het
Ptprs A T 17: 56,417,427 Y1167* probably null Het
Rad54l2 T C 9: 106,717,922 I279V possibly damaging Het
Rora T A 9: 69,373,186 L347Q probably damaging Het
Runx1t1 T G 4: 13,785,136 M1R probably null Het
Sdcbp A G 4: 6,381,064 S70G probably benign Het
Serpinb12 A G 1: 106,953,763 Y210C probably damaging Het
Sipa1 T C 19: 5,651,489 E1015G probably damaging Het
Slc15a2 A C 16: 36,751,782 L740R possibly damaging Het
Specc1 A G 11: 62,156,553 E916G probably damaging Het
Spta1 T C 1: 174,214,177 I1371T possibly damaging Het
Tagln3 T C 16: 45,713,002 M130V probably benign Het
Tchh A T 3: 93,446,445 E1064V unknown Het
Tdp1 A T 12: 99,914,071 S464C probably damaging Het
Tdp1 G C 12: 99,914,072 S464T probably benign Het
Tenm3 T C 8: 48,276,849 Y1374C probably damaging Het
Tmprss3 A T 17: 31,183,859 Y455* probably null Het
Ttc5 A G 14: 50,765,928 V433A possibly damaging Het
Wnt5a A T 14: 28,518,492 R180* probably null Het
Zfp53 A G 17: 21,508,110 D135G probably benign Het
Zfp619 T A 7: 39,537,545 C1000S probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Adam18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Adam18 APN 8 24628133 missense probably damaging 1.00
IGL01649:Adam18 APN 8 24614896 missense possibly damaging 0.82
IGL02212:Adam18 APN 8 24637179 missense probably benign 0.02
IGL02455:Adam18 APN 8 24651848 missense probably damaging 0.96
IGL02525:Adam18 APN 8 24611044 missense probably benign 0.00
IGL02525:Adam18 APN 8 24641767 splice site probably benign
IGL02966:Adam18 APN 8 24611149 splice site probably benign
IGL03136:Adam18 APN 8 24641836 missense probably damaging 1.00
G5030:Adam18 UTSW 8 24651856 missense probably benign 0.24
R0135:Adam18 UTSW 8 24665542 missense possibly damaging 0.71
R0280:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0389:Adam18 UTSW 8 24629637 splice site probably null
R0390:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0443:Adam18 UTSW 8 24629637 splice site probably null
R0479:Adam18 UTSW 8 24651822 missense probably benign
R0578:Adam18 UTSW 8 24641847 missense possibly damaging 0.82
R0645:Adam18 UTSW 8 24672120 nonsense probably null
R0881:Adam18 UTSW 8 24672143 splice site probably benign
R0885:Adam18 UTSW 8 24651786 missense probably damaging 1.00
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0974:Adam18 UTSW 8 24647853 missense probably benign 0.01
R1005:Adam18 UTSW 8 24665514 missense probably benign 0.05
R1356:Adam18 UTSW 8 24668595 splice site probably benign
R1510:Adam18 UTSW 8 24625831 missense probably benign 0.01
R1552:Adam18 UTSW 8 24646361 missense probably benign
R1568:Adam18 UTSW 8 24647783 splice site probably null
R1639:Adam18 UTSW 8 24652152 missense probably benign 0.00
R1968:Adam18 UTSW 8 24646447 missense probably benign 0.32
R2029:Adam18 UTSW 8 24650877 missense probably damaging 1.00
R2058:Adam18 UTSW 8 24672066 splice site probably benign
R2211:Adam18 UTSW 8 24628155 missense probably damaging 0.96
R2237:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2238:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2239:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2518:Adam18 UTSW 8 24637141 missense probably damaging 1.00
R3122:Adam18 UTSW 8 24628232 missense possibly damaging 0.74
R3426:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3428:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3967:Adam18 UTSW 8 24629710 missense probably benign 0.12
R4833:Adam18 UTSW 8 24674101 missense probably benign 0.01
R4965:Adam18 UTSW 8 24641811 missense probably damaging 1.00
R5249:Adam18 UTSW 8 24625852 missense probably benign 0.00
R5534:Adam18 UTSW 8 24665514 missense probably benign 0.05
R5920:Adam18 UTSW 8 24674075 missense probably damaging 1.00
R6450:Adam18 UTSW 8 24629675 missense probably benign 0.05
R6479:Adam18 UTSW 8 24629665 missense probably benign 0.29
R6516:Adam18 UTSW 8 24674687 missense probably damaging 1.00
R6603:Adam18 UTSW 8 24665502 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GGTTGAATGCCTCTGAGAAAACTC -3'
(R):5'- GTCATGTATGCCCTTCAATTATGC -3'

Sequencing Primer
(F):5'- TCGGGCTGTGAAAGATTT -3'
(R):5'- GCACATTCCTCATATTGTATAGCTAC -3'
Posted On2018-04-02