Mutagenetix > Incidental Mutation

Incidental Mutation 'R6329:Rad54l2'

509403

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6329 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106717922 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 279 (I279V)

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046502
AA Change: I279V

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: I279V

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190363

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	T	C	3: 138,173,696	H72R	probably damaging	Het
Abca13	A	T	11: 9,277,937	N660I	probably damaging	Het
Actr8	C	T	14: 29,993,084	R619*	probably null	Het
Adam18	C	A	8: 24,614,827	G657V	probably damaging	Het
Adcyap1	A	G	17: 93,202,799	E85G	probably benign	Het
Akr1c14	A	G	13: 4,087,302	Y305C	probably damaging	Het
Ankdd1b	T	A	13: 96,454,880	H37L	possibly damaging	Het
Ap4e1	T	C	2: 127,061,716	L846P	probably benign	Het
Aqp9	A	T	9: 71,132,684	Y105*	probably null	Het
Arid1b	C	T	17: 5,337,263	Q1664*	probably null	Het
Aup1	A	G	6: 83,054,607		probably benign	Het
Bnip1	C	A	17: 26,786,710	S64*	probably null	Het
Calcr	T	A	6: 3,687,621	Q422L	probably damaging	Het
Ccdc162	T	A	10: 41,663,151	D407V	possibly damaging	Het
Ccdc66	G	T	14: 27,486,484	S760R	probably benign	Het
Cd22	T	A	7: 30,877,768	E38V	probably damaging	Het
Cggbp1	T	C	16: 64,856,020	Y150H	probably damaging	Het
Chd3	T	C	11: 69,361,684	K263R	possibly damaging	Het
Col4a2	T	A	8: 11,446,238	F1620I	probably damaging	Het
Col6a2	T	C	10: 76,599,828	T858A	probably benign	Het
Dnah7a	T	A	1: 53,541,114	D1554V	probably damaging	Het
Dnajc25	A	T	4: 59,013,678	Q132L	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Ehbp1l1	A	C	19: 5,718,767	I836S	possibly damaging	Het
Elf1	A	G	14: 79,573,339	Q288R	possibly damaging	Het
Fbn1	C	A	2: 125,308,473	V2608L	possibly damaging	Het
Frmpd1	T	C	4: 45,268,551	I232T	possibly damaging	Het
Fuca1	T	A	4: 135,934,826	I355N	probably damaging	Het
Gcnt4	A	G	13: 96,947,273	D359G	probably damaging	Het
Gm15448	T	C	7: 3,822,851	T340A	probably damaging	Het
Gm5134	T	C	10: 75,954,660	M30T	possibly damaging	Het
Grk1	T	G	8: 13,405,704	L196R	probably damaging	Het
Igkv14-126	A	C	6: 67,896,564	D92A	probably damaging	Het
Kmt2c	A	G	5: 25,315,602	S1837P	probably benign	Het
Lhx4	T	A	1: 155,702,554	T281S	probably benign	Het
Lrrc55	G	T	2: 85,196,309	H124N	probably benign	Het
March8	T	A	6: 116,406,316	I566N	possibly damaging	Het
Mycbp2	G	A	14: 103,155,852	A3091V	probably benign	Het
Nlrp4b	A	G	7: 10,724,920	N355S	probably benign	Het
Nmur2	A	G	11: 56,029,585	V278A	probably benign	Het
Nod1	T	C	6: 54,944,704	M210V	probably benign	Het
Nt5c1b	T	A	12: 10,372,138	C63*	probably null	Het
Olfr1164	G	A	2: 88,093,664	P91S	probably damaging	Het
Olfr1288	C	T	2: 111,479,228	A148V	possibly damaging	Het
Olfr346	A	T	2: 36,688,682	K227*	probably null	Het
Olfr397	A	G	11: 73,964,742	I45V	possibly damaging	Het
Olfr836	A	C	9: 19,120,957	M1L	probably benign	Het
Olfr884	T	C	9: 38,047,825	V201A	probably benign	Het
Olfr938	C	T	9: 39,077,903	V281I	probably benign	Het
Osbp2	T	A	11: 3,715,153	S517C	probably damaging	Het
Pcdha1	C	T	18: 36,932,248	P655L	probably damaging	Het
Pdcd6	A	G	13: 74,303,979	Y181H	probably damaging	Het
Perp	G	A	10: 18,855,754	G154S	probably damaging	Het
Perp	G	T	10: 18,855,755	G154V	probably damaging	Het
Prokr1	T	G	6: 87,581,792	T204P	possibly damaging	Het
Prpf3	A	T	3: 95,832,578	C630S	probably damaging	Het
Pter	C	A	2: 12,980,548	H230N	probably damaging	Het
Ptprs	A	T	17: 56,417,427	Y1167*	probably null	Het
Rora	T	A	9: 69,373,186	L347Q	probably damaging	Het
Runx1t1	T	G	4: 13,785,136	M1R	probably null	Het
Sdcbp	A	G	4: 6,381,064	S70G	probably benign	Het
Serpinb12	A	G	1: 106,953,763	Y210C	probably damaging	Het
Sipa1	T	C	19: 5,651,489	E1015G	probably damaging	Het
Slc15a2	A	C	16: 36,751,782	L740R	possibly damaging	Het
Specc1	A	G	11: 62,156,553	E916G	probably damaging	Het
Spta1	T	C	1: 174,214,177	I1371T	possibly damaging	Het
Tagln3	T	C	16: 45,713,002	M130V	probably benign	Het
Tchh	A	T	3: 93,446,445	E1064V	unknown	Het
Tdp1	A	T	12: 99,914,071	S464C	probably damaging	Het
Tdp1	G	C	12: 99,914,072	S464T	probably benign	Het
Tenm3	T	C	8: 48,276,849	Y1374C	probably damaging	Het
Tmprss3	A	T	17: 31,183,859	Y455*	probably null	Het
Ttc5	A	G	14: 50,765,928	V433A	possibly damaging	Het
Wnt5a	A	T	14: 28,518,492	R180*	probably null	Het
Zfp53	A	G	17: 21,508,110	D135G	probably benign	Het
Zfp619	T	A	7: 39,537,545	C1000S	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTAAGAGCTCTTACCGGCAC -3'
(R):5'- TGTGTCACCAAGATGACTGTC -3'

Sequencing Primer
(F):5'- TAAGAGCTCTTACCGGCACAATGG -3'
(R):5'- GTGTCACCAAGATGACTGTCACTAG -3'

Posted On

2018-04-02