Mutagenetix > Incidental Mutation

Incidental Mutation 'R6329:Chd3'

509413

Institutional Source

Beutler Lab

Gene Symbol

Chd3

Ensembl Gene

ENSMUSG00000018474

Gene Name

chromodomain helicase DNA binding protein 3

Synonyms

2600010P09Rik, Mi-2 alpha, Chd7, Prp7, Prp9-1

MMRRC Submission

044483-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6329 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69234099-69260232 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69252510 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 263 (K263R)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000144701] [ENSMUST00000154046]

AlphaFold

B1AR17

Predicted Effect

probably benign
Transcript: ENSMUST00000092971
AA Change: K357R

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: K357R

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	199	253	1.4e-34	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1754	1926	8.6e-104	PFAM
low complexity region	1935	1967	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108661
AA Change: K357R

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: K357R

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	200	253	4.3e-29	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1789	1960	4.9e-93	PFAM
low complexity region	1969	2001	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128981
AA Change: K263R

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: K263R

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	55	87	N/A	INTRINSIC
Pfam:CHDNT	107	160	3.9e-29	PFAM
low complexity region	164	190	N/A	INTRINSIC
low complexity region	192	215	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
low complexity region	274	283	N/A	INTRINSIC
low complexity region	305	321	N/A	INTRINSIC
PHD	341	384	1.54e-14	SMART
RING	342	383	4.25e-1	SMART
PHD	417	460	1.74e-13	SMART
RING	418	459	3.93e0	SMART
CHROMO	465	544	7.23e-14	SMART
CHROMO	588	637	2.85e-12	SMART
low complexity region	656	662	N/A	INTRINSIC
DEXDc	691	903	1.64e-31	SMART
low complexity region	1014	1032	N/A	INTRINSIC
HELICc	1049	1133	2.61e-25	SMART
low complexity region	1197	1210	N/A	INTRINSIC
DUF1087	1252	1316	2.98e-33	SMART
DUF1086	1322	1478	1.79e-109	SMART
low complexity region	1480	1509	N/A	INTRINSIC
low complexity region	1579	1592	N/A	INTRINSIC
Pfam:CHDCT2	1662	1833	4.4e-93	PFAM
low complexity region	1842	1874	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000144701
AA Change: K13R

SMART Domains

Protein: ENSMUSP00000114520
Gene: ENSMUSG00000018474
AA Change: K13R

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
low complexity region	23	32	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
PHD	84	127	1.54e-14	SMART
RING	85	126	4.25e-1	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000154046
AA Change: K13R

SMART Domains

Protein: ENSMUSP00000121192
Gene: ENSMUSG00000018474
AA Change: K13R

Domain	Start	End	E-Value	Type
low complexity region	1	29	N/A	INTRINSIC
low complexity region	50	66	N/A	INTRINSIC
PHD	86	129	1.54e-14	SMART
RING	87	128	4.25e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	T	C	3: 137,879,457 (GRCm39)	H72R	probably damaging	Het
Abca13	A	T	11: 9,227,937 (GRCm39)	N660I	probably damaging	Het
Actr8	C	T	14: 29,715,041 (GRCm39)	R619*	probably null	Het
Adam18	C	A	8: 25,104,843 (GRCm39)	G657V	probably damaging	Het
Adcyap1	A	G	17: 93,510,227 (GRCm39)	E85G	probably benign	Het
Akr1c14	A	G	13: 4,137,302 (GRCm39)	Y305C	probably damaging	Het
Ankdd1b	T	A	13: 96,591,388 (GRCm39)	H37L	possibly damaging	Het
Ap4e1	T	C	2: 126,903,636 (GRCm39)	L846P	probably benign	Het
Aqp9	A	T	9: 71,039,966 (GRCm39)	Y105*	probably null	Het
Arid1b	C	T	17: 5,387,538 (GRCm39)	Q1664*	probably null	Het
Aup1	A	G	6: 83,031,588 (GRCm39)		probably benign	Het
Bnip1	C	A	17: 27,005,684 (GRCm39)	S64*	probably null	Het
Calcr	T	A	6: 3,687,621 (GRCm39)	Q422L	probably damaging	Het
Ccdc162	T	A	10: 41,539,147 (GRCm39)	D407V	possibly damaging	Het
Ccdc66	G	T	14: 27,208,441 (GRCm39)	S760R	probably benign	Het
Cd22	T	A	7: 30,577,193 (GRCm39)	E38V	probably damaging	Het
Cggbp1	T	C	16: 64,676,383 (GRCm39)	Y150H	probably damaging	Het
Col4a2	T	A	8: 11,496,238 (GRCm39)	F1620I	probably damaging	Het
Col6a2	T	C	10: 76,435,662 (GRCm39)	T858A	probably benign	Het
Dnah7a	T	A	1: 53,580,273 (GRCm39)	D1554V	probably damaging	Het
Dnajc25	A	T	4: 59,013,678 (GRCm39)	Q132L	probably benign	Het
Dnase1l1	C	T	X: 73,320,644 (GRCm39)		probably null	Homo
Ehbp1l1	A	C	19: 5,768,795 (GRCm39)	I836S	possibly damaging	Het
Elf1	A	G	14: 79,810,779 (GRCm39)	Q288R	possibly damaging	Het
Fbn1	C	A	2: 125,150,393 (GRCm39)	V2608L	possibly damaging	Het
Frmpd1	T	C	4: 45,268,551 (GRCm39)	I232T	possibly damaging	Het
Fuca1	T	A	4: 135,662,137 (GRCm39)	I355N	probably damaging	Het
Gcnt4	A	G	13: 97,083,781 (GRCm39)	D359G	probably damaging	Het
Gm5134	T	C	10: 75,790,494 (GRCm39)	M30T	possibly damaging	Het
Grk1	T	G	8: 13,455,704 (GRCm39)	L196R	probably damaging	Het
Igkv14-126	A	C	6: 67,873,548 (GRCm39)	D92A	probably damaging	Het
Kmt2c	A	G	5: 25,520,600 (GRCm39)	S1837P	probably benign	Het
Lhx4	T	A	1: 155,578,300 (GRCm39)	T281S	probably benign	Het
Lrrc55	G	T	2: 85,026,653 (GRCm39)	H124N	probably benign	Het
Marchf8	T	A	6: 116,383,277 (GRCm39)	I566N	possibly damaging	Het
Mycbp2	G	A	14: 103,393,288 (GRCm39)	A3091V	probably benign	Het
Nlrp4b	A	G	7: 10,458,847 (GRCm39)	N355S	probably benign	Het
Nmur2	A	G	11: 55,920,411 (GRCm39)	V278A	probably benign	Het
Nod1	T	C	6: 54,921,689 (GRCm39)	M210V	probably benign	Het
Nt5c1b	T	A	12: 10,422,138 (GRCm39)	C63*	probably null	Het
Or1e1f	A	G	11: 73,855,568 (GRCm39)	I45V	possibly damaging	Het
Or1j17	A	T	2: 36,578,694 (GRCm39)	K227*	probably null	Het
Or4g7	C	T	2: 111,309,573 (GRCm39)	A148V	possibly damaging	Het
Or5d37	G	A	2: 87,924,008 (GRCm39)	P91S	probably damaging	Het
Or7g21	A	C	9: 19,032,253 (GRCm39)	M1L	probably benign	Het
Or8b37	T	C	9: 37,959,121 (GRCm39)	V201A	probably benign	Het
Or8g24	C	T	9: 38,989,199 (GRCm39)	V281I	probably benign	Het
Osbp2	T	A	11: 3,665,153 (GRCm39)	S517C	probably damaging	Het
Pcdha1	C	T	18: 37,065,301 (GRCm39)	P655L	probably damaging	Het
Pdcd6	A	G	13: 74,452,098 (GRCm39)	Y181H	probably damaging	Het
Perp	G	A	10: 18,731,502 (GRCm39)	G154S	probably damaging	Het
Perp	G	T	10: 18,731,503 (GRCm39)	G154V	probably damaging	Het
Pira13	T	C	7: 3,825,850 (GRCm39)	T340A	probably damaging	Het
Prokr1	T	G	6: 87,558,774 (GRCm39)	T204P	possibly damaging	Het
Prpf3	A	T	3: 95,739,890 (GRCm39)	C630S	probably damaging	Het
Pter	C	A	2: 12,985,359 (GRCm39)	H230N	probably damaging	Het
Ptprs	A	T	17: 56,724,427 (GRCm39)	Y1167*	probably null	Het
Rad54l2	T	C	9: 106,595,121 (GRCm39)	I279V	possibly damaging	Het
Rora	T	A	9: 69,280,468 (GRCm39)	L347Q	probably damaging	Het
Runx1t1	T	G	4: 13,785,136 (GRCm39)	M1R	probably null	Het
Sdcbp	A	G	4: 6,381,064 (GRCm39)	S70G	probably benign	Het
Serpinb12	A	G	1: 106,881,493 (GRCm39)	Y210C	probably damaging	Het
Sipa1	T	C	19: 5,701,517 (GRCm39)	E1015G	probably damaging	Het
Slc15a2	A	C	16: 36,572,144 (GRCm39)	L740R	possibly damaging	Het
Specc1	A	G	11: 62,047,379 (GRCm39)	E916G	probably damaging	Het
Spta1	T	C	1: 174,041,743 (GRCm39)	I1371T	possibly damaging	Het
Tagln3	T	C	16: 45,533,365 (GRCm39)	M130V	probably benign	Het
Tchh	A	T	3: 93,353,752 (GRCm39)	E1064V	unknown	Het
Tdp1	A	T	12: 99,880,330 (GRCm39)	S464C	probably damaging	Het
Tdp1	G	C	12: 99,880,331 (GRCm39)	S464T	probably benign	Het
Tenm3	T	C	8: 48,729,884 (GRCm39)	Y1374C	probably damaging	Het
Tmprss3	A	T	17: 31,402,833 (GRCm39)	Y455*	probably null	Het
Ttc5	A	G	14: 51,003,385 (GRCm39)	V433A	possibly damaging	Het
Wnt5a	A	T	14: 28,240,449 (GRCm39)	R180*	probably null	Het
Zfp53	A	G	17: 21,728,372 (GRCm39)	D135G	probably benign	Het
Zfp619	T	A	7: 39,186,969 (GRCm39)	C1000S	probably damaging	Het
Zfp647	G	A	15: 76,796,285 (GRCm39)	P125L	probably damaging	Het

Other mutations in Chd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Chd3	APN	11	69,247,888 (GRCm39)	missense	probably damaging	0.96
IGL00551:Chd3	APN	11	69,237,455 (GRCm39)	missense	probably damaging	1.00
IGL00661:Chd3	APN	11	69,248,209 (GRCm39)	missense	possibly damaging	0.84
IGL00698:Chd3	APN	11	69,240,697 (GRCm39)	missense	probably damaging	0.98
IGL01075:Chd3	APN	11	69,250,791 (GRCm39)	missense	probably damaging	1.00
IGL01309:Chd3	APN	11	69,248,557 (GRCm39)	missense	probably damaging	0.99
IGL01317:Chd3	APN	11	69,244,037 (GRCm39)	missense	probably damaging	1.00
IGL01374:Chd3	APN	11	69,250,806 (GRCm39)	missense	probably damaging	0.99
IGL01444:Chd3	APN	11	69,239,568 (GRCm39)	missense	probably benign	0.28
IGL01617:Chd3	APN	11	69,249,060 (GRCm39)	unclassified	probably benign
IGL01635:Chd3	APN	11	69,252,076 (GRCm39)	splice site	probably benign
IGL01942:Chd3	APN	11	69,240,931 (GRCm39)	critical splice donor site	probably null
IGL01962:Chd3	APN	11	69,248,319 (GRCm39)	missense	possibly damaging	0.46
IGL01981:Chd3	APN	11	69,251,501 (GRCm39)	missense	probably damaging	0.99
IGL02022:Chd3	APN	11	69,251,886 (GRCm39)	missense	probably damaging	1.00
IGL02098:Chd3	APN	11	69,250,655 (GRCm39)	missense	probably damaging	1.00
IGL02218:Chd3	APN	11	69,242,920 (GRCm39)	unclassified	probably benign
IGL02415:Chd3	APN	11	69,239,739 (GRCm39)	splice site	probably benign
IGL02648:Chd3	APN	11	69,242,976 (GRCm39)	missense	probably damaging	1.00
IGL02951:Chd3	APN	11	69,251,874 (GRCm39)	critical splice donor site	probably null
IGL03030:Chd3	APN	11	69,245,230 (GRCm39)	missense	possibly damaging	0.64
IGL03102:Chd3	APN	11	69,252,022 (GRCm39)	nonsense	probably null
IGL03168:Chd3	APN	11	69,239,741 (GRCm39)	splice site	probably benign
IGL03327:Chd3	APN	11	69,241,012 (GRCm39)	missense	probably damaging	1.00
burg	UTSW	11	69,247,380 (GRCm39)	missense	probably damaging	1.00
castello	UTSW	11	69,246,648 (GRCm39)	critical splice acceptor site	probably benign
feste	UTSW	11	69,245,252 (GRCm39)	nonsense	probably null
Fortress	UTSW	11	69,254,876 (GRCm39)	nonsense	probably null
moat	UTSW	11	69,250,011 (GRCm39)	missense	probably damaging	0.98
Redoubt	UTSW	11	69,244,727 (GRCm39)	unclassified	probably benign
schloss	UTSW	11	69,252,886 (GRCm39)	nonsense	probably null
siege	UTSW	11	69,247,844 (GRCm39)	missense	probably damaging	1.00
R0009:Chd3	UTSW	11	69,240,732 (GRCm39)	missense	probably damaging	0.99
R0009:Chd3	UTSW	11	69,240,732 (GRCm39)	missense	probably damaging	0.99
R0056:Chd3	UTSW	11	69,250,739 (GRCm39)	unclassified	probably benign
R0129:Chd3	UTSW	11	69,239,327 (GRCm39)	nonsense	probably null
R0130:Chd3	UTSW	11	69,250,656 (GRCm39)	missense	probably damaging	1.00
R0309:Chd3	UTSW	11	69,247,844 (GRCm39)	missense	probably damaging	1.00
R0330:Chd3	UTSW	11	69,247,159 (GRCm39)	missense	probably damaging	1.00
R0449:Chd3	UTSW	11	69,248,367 (GRCm39)	missense	probably damaging	0.98
R0502:Chd3	UTSW	11	69,244,931 (GRCm39)	missense	probably damaging	0.98
R0540:Chd3	UTSW	11	69,235,184 (GRCm39)	missense	probably damaging	0.98
R0571:Chd3	UTSW	11	69,252,495 (GRCm39)	critical splice donor site	probably null
R0607:Chd3	UTSW	11	69,235,184 (GRCm39)	missense	probably damaging	0.98
R0616:Chd3	UTSW	11	69,236,313 (GRCm39)	missense	probably damaging	0.96
R0630:Chd3	UTSW	11	69,238,021 (GRCm39)	missense	probably damaging	1.00
R1436:Chd3	UTSW	11	69,248,400 (GRCm39)	splice site	probably null
R1484:Chd3	UTSW	11	69,250,725 (GRCm39)	missense	probably benign	0.17
R1741:Chd3	UTSW	11	69,246,480 (GRCm39)	missense	probably damaging	1.00
R1748:Chd3	UTSW	11	69,255,523 (GRCm39)	missense	possibly damaging	0.81
R1751:Chd3	UTSW	11	69,244,727 (GRCm39)	unclassified	probably benign
R1833:Chd3	UTSW	11	69,244,949 (GRCm39)	missense	probably damaging	1.00
R2012:Chd3	UTSW	11	69,239,878 (GRCm39)	missense	probably benign	0.01
R2101:Chd3	UTSW	11	69,239,877 (GRCm39)	missense	probably benign
R2147:Chd3	UTSW	11	69,239,854 (GRCm39)	missense	probably benign	0.00
R2513:Chd3	UTSW	11	69,251,471 (GRCm39)	missense	probably damaging	1.00
R2877:Chd3	UTSW	11	69,251,998 (GRCm39)	nonsense	probably null
R2879:Chd3	UTSW	11	69,254,924 (GRCm39)	missense	possibly damaging	0.52
R2880:Chd3	UTSW	11	69,242,946 (GRCm39)	missense	probably damaging	1.00
R2881:Chd3	UTSW	11	69,242,946 (GRCm39)	missense	probably damaging	1.00
R2973:Chd3	UTSW	11	69,251,442 (GRCm39)	missense	probably damaging	1.00
R3611:Chd3	UTSW	11	69,252,973 (GRCm39)	missense	possibly damaging	0.53
R3743:Chd3	UTSW	11	69,254,876 (GRCm39)	nonsense	probably null
R3845:Chd3	UTSW	11	69,237,585 (GRCm39)	missense	possibly damaging	0.65
R3889:Chd3	UTSW	11	69,250,011 (GRCm39)	missense	probably damaging	0.98
R4007:Chd3	UTSW	11	69,239,827 (GRCm39)	missense	probably benign
R4115:Chd3	UTSW	11	69,248,343 (GRCm39)	missense	possibly damaging	0.95
R4515:Chd3	UTSW	11	69,240,703 (GRCm39)	missense	probably benign	0.00
R4612:Chd3	UTSW	11	69,244,035 (GRCm39)	nonsense	probably null
R4622:Chd3	UTSW	11	69,239,834 (GRCm39)	missense	probably damaging	0.98
R4634:Chd3	UTSW	11	69,253,013 (GRCm39)	unclassified	probably benign
R4635:Chd3	UTSW	11	69,253,013 (GRCm39)	unclassified	probably benign
R4859:Chd3	UTSW	11	69,250,722 (GRCm39)	missense	possibly damaging	0.79
R4930:Chd3	UTSW	11	69,245,034 (GRCm39)	unclassified	probably benign
R5173:Chd3	UTSW	11	69,260,069 (GRCm39)	unclassified	probably benign
R5287:Chd3	UTSW	11	69,239,895 (GRCm39)	splice site	probably null
R5403:Chd3	UTSW	11	69,239,895 (GRCm39)	splice site	probably null
R5511:Chd3	UTSW	11	69,252,301 (GRCm39)	missense	probably damaging	1.00
R5666:Chd3	UTSW	11	69,244,177 (GRCm39)	missense	possibly damaging	0.83
R5702:Chd3	UTSW	11	69,252,261 (GRCm39)	missense	possibly damaging	0.46
R6045:Chd3	UTSW	11	69,242,944 (GRCm39)	missense	possibly damaging	0.90
R6063:Chd3	UTSW	11	69,240,063 (GRCm39)	missense	probably benign
R6211:Chd3	UTSW	11	69,243,503 (GRCm39)	missense	probably damaging	1.00
R6215:Chd3	UTSW	11	69,247,380 (GRCm39)	missense	probably damaging	1.00
R6217:Chd3	UTSW	11	69,236,361 (GRCm39)	missense	probably damaging	1.00
R6302:Chd3	UTSW	11	69,244,604 (GRCm39)	missense	probably damaging	0.98
R6349:Chd3	UTSW	11	69,254,857 (GRCm39)	missense	possibly damaging	0.50
R6414:Chd3	UTSW	11	69,243,371 (GRCm39)	critical splice donor site	probably null
R6453:Chd3	UTSW	11	69,240,938 (GRCm39)	nonsense	probably null
R6548:Chd3	UTSW	11	69,252,886 (GRCm39)	nonsense	probably null
R6582:Chd3	UTSW	11	69,259,982 (GRCm39)	unclassified	probably benign
R6721:Chd3	UTSW	11	69,260,045 (GRCm39)	unclassified	probably benign
R6776:Chd3	UTSW	11	69,245,296 (GRCm39)	missense	probably damaging	1.00
R6900:Chd3	UTSW	11	69,245,271 (GRCm39)	missense	possibly damaging	0.64
R7085:Chd3	UTSW	11	69,260,027 (GRCm39)	missense	unknown
R7136:Chd3	UTSW	11	69,239,264 (GRCm39)	missense	probably null	0.37
R7164:Chd3	UTSW	11	69,253,132 (GRCm39)	missense	probably damaging	1.00
R7200:Chd3	UTSW	11	69,254,921 (GRCm39)	missense	possibly damaging	0.94
R7226:Chd3	UTSW	11	69,260,037 (GRCm39)	missense	unknown
R7238:Chd3	UTSW	11	69,254,873 (GRCm39)	missense	probably benign	0.31
R7316:Chd3	UTSW	11	69,236,394 (GRCm39)	missense	probably damaging	0.99
R7560:Chd3	UTSW	11	69,247,096 (GRCm39)	missense	probably damaging	1.00
R7684:Chd3	UTSW	11	69,248,692 (GRCm39)	missense	possibly damaging	0.83
R7748:Chd3	UTSW	11	69,246,459 (GRCm39)	missense	probably benign	0.00
R7820:Chd3	UTSW	11	69,244,064 (GRCm39)	missense	probably damaging	1.00
R7885:Chd3	UTSW	11	69,247,451 (GRCm39)	missense	probably benign	0.13
R8150:Chd3	UTSW	11	69,254,510 (GRCm39)	missense	probably benign	0.02
R8161:Chd3	UTSW	11	69,241,711 (GRCm39)	missense	probably damaging	1.00
R8271:Chd3	UTSW	11	69,251,483 (GRCm39)	missense	probably damaging	1.00
R8334:Chd3	UTSW	11	69,241,622 (GRCm39)	missense	probably damaging	1.00
R8423:Chd3	UTSW	11	69,245,252 (GRCm39)	nonsense	probably null
R8690:Chd3	UTSW	11	69,246,648 (GRCm39)	critical splice acceptor site	probably benign
R8828:Chd3	UTSW	11	69,247,097 (GRCm39)	missense	probably damaging	1.00
R8857:Chd3	UTSW	11	69,253,146 (GRCm39)	missense	probably benign	0.22
R9124:Chd3	UTSW	11	69,260,162 (GRCm39)	missense	unknown
R9170:Chd3	UTSW	11	69,241,648 (GRCm39)	missense	possibly damaging	0.64
R9213:Chd3	UTSW	11	69,255,628 (GRCm39)	missense	possibly damaging	0.53
R9285:Chd3	UTSW	11	69,249,954 (GRCm39)	missense	possibly damaging	0.64
R9293:Chd3	UTSW	11	69,244,027 (GRCm39)	missense	possibly damaging	0.94
R9368:Chd3	UTSW	11	69,251,200 (GRCm39)	missense	probably damaging	1.00
R9521:Chd3	UTSW	11	69,249,133 (GRCm39)	missense	probably benign	0.01
R9544:Chd3	UTSW	11	69,241,046 (GRCm39)	missense	probably damaging	1.00
R9554:Chd3	UTSW	11	69,251,015 (GRCm39)	missense	probably damaging	1.00
R9588:Chd3	UTSW	11	69,241,046 (GRCm39)	missense	probably damaging	1.00
X0022:Chd3	UTSW	11	69,247,084 (GRCm39)	missense	probably damaging	1.00
X0062:Chd3	UTSW	11	69,245,271 (GRCm39)	missense	possibly damaging	0.64
Z1186:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1186:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1187:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1187:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1188:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1188:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1189:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1189:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1190:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1190:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1191:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1191:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1192:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1192:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCACTATGGACACTACCACTGTC -3'
(R):5'- CTCCACCAGGATGTGTCATG -3'

Sequencing Primer
(F):5'- GACACTACCACTGTCCAGGTCTG -3'
(R):5'- AGGATGTGTCATGGCCCAC -3'

Posted On

2018-04-02