Incidental Mutation 'R6329:Nt5c1b'
ID509415
Institutional Source Beutler Lab
Gene Symbol Nt5c1b
Ensembl Gene ENSMUSG00000020622
Gene Name5'-nucleotidase, cytosolic IB
Synonyms4921514H13Rik, CN-IB
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6329 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location10369973-10390175 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 10372138 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 63 (C63*)
Ref Sequence ENSEMBL: ENSMUSP00000151627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002456] [ENSMUST00000118657] [ENSMUST00000143739] [ENSMUST00000147323] [ENSMUST00000217944] [ENSMUST00000218026] [ENSMUST00000218287] [ENSMUST00000218327] [ENSMUST00000218339] [ENSMUST00000218417] [ENSMUST00000219826] [ENSMUST00000220257] [ENSMUST00000219292] [ENSMUST00000223534] [ENSMUST00000218551] [ENSMUST00000219049] [ENSMUST00000220611]
Predicted Effect probably benign
Transcript: ENSMUST00000002456
SMART Domains Protein: ENSMUSP00000002456
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 570 1.6e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118657
SMART Domains Protein: ENSMUSP00000112694
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 91 103 N/A INTRINSIC
low complexity region 135 143 N/A INTRINSIC
low complexity region 225 231 N/A INTRINSIC
Pfam:5-nucleotidase 280 553 7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143739
SMART Domains Protein: ENSMUSP00000123105
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 151 163 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147323
SMART Domains Protein: ENSMUSP00000117869
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 466 4.8e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217944
AA Change: C63*
Predicted Effect probably benign
Transcript: ENSMUST00000218026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218148
Predicted Effect probably null
Transcript: ENSMUST00000218287
AA Change: C63*
Predicted Effect probably benign
Transcript: ENSMUST00000218288
Predicted Effect probably benign
Transcript: ENSMUST00000218327
Predicted Effect probably benign
Transcript: ENSMUST00000218339
Predicted Effect probably null
Transcript: ENSMUST00000218417
AA Change: C63*
Predicted Effect probably null
Transcript: ENSMUST00000219826
AA Change: C63*
Predicted Effect probably null
Transcript: ENSMUST00000220257
AA Change: C63*
Predicted Effect probably benign
Transcript: ENSMUST00000219292
Predicted Effect probably benign
Transcript: ENSMUST00000223534
Predicted Effect probably benign
Transcript: ENSMUST00000218551
Predicted Effect probably benign
Transcript: ENSMUST00000219049
Predicted Effect probably benign
Transcript: ENSMUST00000220611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219281
Predicted Effect probably benign
Transcript: ENSMUST00000219630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic 5-prime nucleotidases, such as NT5C1B, catalyze production of adenosine, which regulates diverse physiologic processes (Sala-Newby and Newby, 2001 [PubMed 11690631]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,173,696 H72R probably damaging Het
Abca13 A T 11: 9,277,937 N660I probably damaging Het
Actr8 C T 14: 29,993,084 R619* probably null Het
Adam18 C A 8: 24,614,827 G657V probably damaging Het
Adcyap1 A G 17: 93,202,799 E85G probably benign Het
Akr1c14 A G 13: 4,087,302 Y305C probably damaging Het
Ankdd1b T A 13: 96,454,880 H37L possibly damaging Het
Ap4e1 T C 2: 127,061,716 L846P probably benign Het
Aqp9 A T 9: 71,132,684 Y105* probably null Het
Arid1b C T 17: 5,337,263 Q1664* probably null Het
Aup1 A G 6: 83,054,607 probably benign Het
Bnip1 C A 17: 26,786,710 S64* probably null Het
Calcr T A 6: 3,687,621 Q422L probably damaging Het
Ccdc162 T A 10: 41,663,151 D407V possibly damaging Het
Ccdc66 G T 14: 27,486,484 S760R probably benign Het
Cd22 T A 7: 30,877,768 E38V probably damaging Het
Cggbp1 T C 16: 64,856,020 Y150H probably damaging Het
Chd3 T C 11: 69,361,684 K263R possibly damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a2 T C 10: 76,599,828 T858A probably benign Het
Dnah7a T A 1: 53,541,114 D1554V probably damaging Het
Dnajc25 A T 4: 59,013,678 Q132L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Ehbp1l1 A C 19: 5,718,767 I836S possibly damaging Het
Elf1 A G 14: 79,573,339 Q288R possibly damaging Het
Fbn1 C A 2: 125,308,473 V2608L possibly damaging Het
Frmpd1 T C 4: 45,268,551 I232T possibly damaging Het
Fuca1 T A 4: 135,934,826 I355N probably damaging Het
Gcnt4 A G 13: 96,947,273 D359G probably damaging Het
Gm15448 T C 7: 3,822,851 T340A probably damaging Het
Gm5134 T C 10: 75,954,660 M30T possibly damaging Het
Grk1 T G 8: 13,405,704 L196R probably damaging Het
Igkv14-126 A C 6: 67,896,564 D92A probably damaging Het
Kmt2c A G 5: 25,315,602 S1837P probably benign Het
Lhx4 T A 1: 155,702,554 T281S probably benign Het
Lrrc55 G T 2: 85,196,309 H124N probably benign Het
March8 T A 6: 116,406,316 I566N possibly damaging Het
Mycbp2 G A 14: 103,155,852 A3091V probably benign Het
Nlrp4b A G 7: 10,724,920 N355S probably benign Het
Nmur2 A G 11: 56,029,585 V278A probably benign Het
Nod1 T C 6: 54,944,704 M210V probably benign Het
Olfr1164 G A 2: 88,093,664 P91S probably damaging Het
Olfr1288 C T 2: 111,479,228 A148V possibly damaging Het
Olfr346 A T 2: 36,688,682 K227* probably null Het
Olfr397 A G 11: 73,964,742 I45V possibly damaging Het
Olfr836 A C 9: 19,120,957 M1L probably benign Het
Olfr884 T C 9: 38,047,825 V201A probably benign Het
Olfr938 C T 9: 39,077,903 V281I probably benign Het
Osbp2 T A 11: 3,715,153 S517C probably damaging Het
Pcdha1 C T 18: 36,932,248 P655L probably damaging Het
Pdcd6 A G 13: 74,303,979 Y181H probably damaging Het
Perp G A 10: 18,855,754 G154S probably damaging Het
Perp G T 10: 18,855,755 G154V probably damaging Het
Prokr1 T G 6: 87,581,792 T204P possibly damaging Het
Prpf3 A T 3: 95,832,578 C630S probably damaging Het
Pter C A 2: 12,980,548 H230N probably damaging Het
Ptprs A T 17: 56,417,427 Y1167* probably null Het
Rad54l2 T C 9: 106,717,922 I279V possibly damaging Het
Rora T A 9: 69,373,186 L347Q probably damaging Het
Runx1t1 T G 4: 13,785,136 M1R probably null Het
Sdcbp A G 4: 6,381,064 S70G probably benign Het
Serpinb12 A G 1: 106,953,763 Y210C probably damaging Het
Sipa1 T C 19: 5,651,489 E1015G probably damaging Het
Slc15a2 A C 16: 36,751,782 L740R possibly damaging Het
Specc1 A G 11: 62,156,553 E916G probably damaging Het
Spta1 T C 1: 174,214,177 I1371T possibly damaging Het
Tagln3 T C 16: 45,713,002 M130V probably benign Het
Tchh A T 3: 93,446,445 E1064V unknown Het
Tdp1 A T 12: 99,914,071 S464C probably damaging Het
Tdp1 G C 12: 99,914,072 S464T probably benign Het
Tenm3 T C 8: 48,276,849 Y1374C probably damaging Het
Tmprss3 A T 17: 31,183,859 Y455* probably null Het
Ttc5 A G 14: 50,765,928 V433A possibly damaging Het
Wnt5a A T 14: 28,518,492 R180* probably null Het
Zfp53 A G 17: 21,508,110 D135G probably benign Het
Zfp619 T A 7: 39,537,545 C1000S probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Nt5c1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Nt5c1b APN 12 10374798 missense probably benign 0.00
IGL01737:Nt5c1b APN 12 10390108 missense possibly damaging 0.93
IGL02114:Nt5c1b APN 12 10375444 missense probably damaging 1.00
IGL02131:Nt5c1b APN 12 10375491 missense possibly damaging 0.75
IGL02135:Nt5c1b APN 12 10377194 missense probably damaging 1.00
IGL02871:Nt5c1b APN 12 10381325 missense probably damaging 1.00
IGL03003:Nt5c1b APN 12 10374910 missense possibly damaging 0.90
IGL03327:Nt5c1b APN 12 10374861 nonsense probably null
R0838:Nt5c1b UTSW 12 10375071 nonsense probably null
R1340:Nt5c1b UTSW 12 10377276 missense probably damaging 1.00
R1480:Nt5c1b UTSW 12 10374886 missense probably damaging 1.00
R1599:Nt5c1b UTSW 12 10390024 missense probably damaging 1.00
R1674:Nt5c1b UTSW 12 10370055 start gained probably benign
R1691:Nt5c1b UTSW 12 10375537 missense possibly damaging 0.95
R2237:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2238:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2238:Nt5c1b UTSW 12 10390108 missense probably damaging 1.00
R2239:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2260:Nt5c1b UTSW 12 10374965 missense probably damaging 1.00
R2424:Nt5c1b UTSW 12 10370072 missense probably damaging 1.00
R3607:Nt5c1b UTSW 12 10377236 missense probably damaging 1.00
R4276:Nt5c1b UTSW 12 10374886 missense probably damaging 1.00
R4582:Nt5c1b UTSW 12 10390054 missense probably damaging 1.00
R4711:Nt5c1b UTSW 12 10370093 missense probably damaging 1.00
R4775:Nt5c1b UTSW 12 10375449 missense probably damaging 1.00
R5840:Nt5c1b UTSW 12 10377171 missense probably damaging 1.00
R5940:Nt5c1b UTSW 12 10375515 missense probably damaging 1.00
R6104:Nt5c1b UTSW 12 10372955 missense probably damaging 1.00
R6626:Nt5c1b UTSW 12 10374837 nonsense probably null
R6722:Nt5c1b UTSW 12 10372874 missense possibly damaging 0.48
R7424:Nt5c1b UTSW 12 10381391 splice site probably null
R7491:Nt5c1b UTSW 12 10374903 missense probably benign 0.00
R7714:Nt5c1b UTSW 12 10375472 missense probably damaging 1.00
R8008:Nt5c1b UTSW 12 10375000 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CCTCCCTGTTCAGGAAGAATG -3'
(R):5'- GGAGAGGCAAGTGGACTATTTTC -3'

Sequencing Primer
(F):5'- CCTCCCTGTTCAGGAAGAATGATAAG -3'
(R):5'- AGGCAAGTGGACTATTTTCTGTCCC -3'
Posted On2018-04-02