Incidental Mutation 'R6329:Tdp1'
ID509416
Institutional Source Beutler Lab
Gene Symbol Tdp1
Ensembl Gene ENSMUSG00000021177
Gene Nametyrosyl-DNA phosphodiesterase 1
SynonymsE430034L06Rik, 2810481F14Rik, SCAN1, 4921509N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R6329 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location99884517-99955219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99914071 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 464 (S464C)
Ref Sequence ENSEMBL: ENSMUSP00000118656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021594] [ENSMUST00000153627]
Predicted Effect probably damaging
Transcript: ENSMUST00000021594
AA Change: S464C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021594
Gene: ENSMUSG00000021177
AA Change: S464C

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
Pfam:Tyr-DNA_phospho 164 583 2.7e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151019
Predicted Effect probably damaging
Transcript: ENSMUST00000153627
AA Change: S464C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118656
Gene: ENSMUSG00000021177
AA Change: S464C

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
Pfam:Tyr-DNA_phospho 166 583 2.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220685
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in repairing stalled topoisomerase I-DNA complexes by catalyzing the hydrolysis of the phosphodiester bond between the tyrosine residue of topoisomerase I and the 3-prime phosphate of DNA. This protein may also remove glycolate from single-stranded DNA containing 3-prime phosphoglycolate, suggesting a role in repair of free-radical mediated DNA double-strand breaks. This gene is a member of the phospholipase D family and contains two PLD phosphodiesterase domains. Mutations in this gene are associated with the disease spinocerebellar ataxia with axonal neuropathy (SCAN1). [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit defective single strand DNA repair in neurons, decreased cerebellum size and increased sensitivity to topotecan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,173,696 H72R probably damaging Het
Abca13 A T 11: 9,277,937 N660I probably damaging Het
Actr8 C T 14: 29,993,084 R619* probably null Het
Adam18 C A 8: 24,614,827 G657V probably damaging Het
Adcyap1 A G 17: 93,202,799 E85G probably benign Het
Akr1c14 A G 13: 4,087,302 Y305C probably damaging Het
Ankdd1b T A 13: 96,454,880 H37L possibly damaging Het
Ap4e1 T C 2: 127,061,716 L846P probably benign Het
Aqp9 A T 9: 71,132,684 Y105* probably null Het
Arid1b C T 17: 5,337,263 Q1664* probably null Het
Aup1 A G 6: 83,054,607 probably benign Het
Bnip1 C A 17: 26,786,710 S64* probably null Het
Calcr T A 6: 3,687,621 Q422L probably damaging Het
Ccdc162 T A 10: 41,663,151 D407V possibly damaging Het
Ccdc66 G T 14: 27,486,484 S760R probably benign Het
Cd22 T A 7: 30,877,768 E38V probably damaging Het
Cggbp1 T C 16: 64,856,020 Y150H probably damaging Het
Chd3 T C 11: 69,361,684 K263R possibly damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a2 T C 10: 76,599,828 T858A probably benign Het
Dnah7a T A 1: 53,541,114 D1554V probably damaging Het
Dnajc25 A T 4: 59,013,678 Q132L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Ehbp1l1 A C 19: 5,718,767 I836S possibly damaging Het
Elf1 A G 14: 79,573,339 Q288R possibly damaging Het
Fbn1 C A 2: 125,308,473 V2608L possibly damaging Het
Frmpd1 T C 4: 45,268,551 I232T possibly damaging Het
Fuca1 T A 4: 135,934,826 I355N probably damaging Het
Gcnt4 A G 13: 96,947,273 D359G probably damaging Het
Gm15448 T C 7: 3,822,851 T340A probably damaging Het
Gm5134 T C 10: 75,954,660 M30T possibly damaging Het
Grk1 T G 8: 13,405,704 L196R probably damaging Het
Igkv14-126 A C 6: 67,896,564 D92A probably damaging Het
Kmt2c A G 5: 25,315,602 S1837P probably benign Het
Lhx4 T A 1: 155,702,554 T281S probably benign Het
Lrrc55 G T 2: 85,196,309 H124N probably benign Het
March8 T A 6: 116,406,316 I566N possibly damaging Het
Mycbp2 G A 14: 103,155,852 A3091V probably benign Het
Nlrp4b A G 7: 10,724,920 N355S probably benign Het
Nmur2 A G 11: 56,029,585 V278A probably benign Het
Nod1 T C 6: 54,944,704 M210V probably benign Het
Nt5c1b T A 12: 10,372,138 C63* probably null Het
Olfr1164 G A 2: 88,093,664 P91S probably damaging Het
Olfr1288 C T 2: 111,479,228 A148V possibly damaging Het
Olfr346 A T 2: 36,688,682 K227* probably null Het
Olfr397 A G 11: 73,964,742 I45V possibly damaging Het
Olfr836 A C 9: 19,120,957 M1L probably benign Het
Olfr884 T C 9: 38,047,825 V201A probably benign Het
Olfr938 C T 9: 39,077,903 V281I probably benign Het
Osbp2 T A 11: 3,715,153 S517C probably damaging Het
Pcdha1 C T 18: 36,932,248 P655L probably damaging Het
Pdcd6 A G 13: 74,303,979 Y181H probably damaging Het
Perp G A 10: 18,855,754 G154S probably damaging Het
Perp G T 10: 18,855,755 G154V probably damaging Het
Prokr1 T G 6: 87,581,792 T204P possibly damaging Het
Prpf3 A T 3: 95,832,578 C630S probably damaging Het
Pter C A 2: 12,980,548 H230N probably damaging Het
Ptprs A T 17: 56,417,427 Y1167* probably null Het
Rad54l2 T C 9: 106,717,922 I279V possibly damaging Het
Rora T A 9: 69,373,186 L347Q probably damaging Het
Runx1t1 T G 4: 13,785,136 M1R probably null Het
Sdcbp A G 4: 6,381,064 S70G probably benign Het
Serpinb12 A G 1: 106,953,763 Y210C probably damaging Het
Sipa1 T C 19: 5,651,489 E1015G probably damaging Het
Slc15a2 A C 16: 36,751,782 L740R possibly damaging Het
Specc1 A G 11: 62,156,553 E916G probably damaging Het
Spta1 T C 1: 174,214,177 I1371T possibly damaging Het
Tagln3 T C 16: 45,713,002 M130V probably benign Het
Tchh A T 3: 93,446,445 E1064V unknown Het
Tenm3 T C 8: 48,276,849 Y1374C probably damaging Het
Tmprss3 A T 17: 31,183,859 Y455* probably null Het
Ttc5 A G 14: 50,765,928 V433A possibly damaging Het
Wnt5a A T 14: 28,518,492 R180* probably null Het
Zfp53 A G 17: 21,508,110 D135G probably benign Het
Zfp619 T A 7: 39,537,545 C1000S probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Tdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Tdp1 APN 12 99893648 missense possibly damaging 0.79
IGL01099:Tdp1 APN 12 99915445 splice site probably benign
IGL01295:Tdp1 APN 12 99891670 missense probably benign 0.00
IGL01409:Tdp1 APN 12 99909681 missense possibly damaging 0.83
IGL01482:Tdp1 APN 12 99891380 missense probably benign
IGL03116:Tdp1 APN 12 99955031 missense probably benign 0.27
R0008:Tdp1 UTSW 12 99954958 splice site probably benign
R0033:Tdp1 UTSW 12 99935052 missense probably benign 0.30
R0092:Tdp1 UTSW 12 99954989 missense probably damaging 1.00
R0485:Tdp1 UTSW 12 99909842 missense probably benign 0.30
R0611:Tdp1 UTSW 12 99909711 missense probably benign
R0853:Tdp1 UTSW 12 99935067 missense probably damaging 0.96
R1539:Tdp1 UTSW 12 99912312 missense probably damaging 1.00
R1692:Tdp1 UTSW 12 99955001 missense probably damaging 1.00
R1751:Tdp1 UTSW 12 99891343 unclassified probably null
R1767:Tdp1 UTSW 12 99891343 unclassified probably null
R3788:Tdp1 UTSW 12 99891752 splice site probably benign
R3790:Tdp1 UTSW 12 99891752 splice site probably benign
R3837:Tdp1 UTSW 12 99894708 critical splice acceptor site probably null
R3917:Tdp1 UTSW 12 99894717 missense probably damaging 1.00
R4209:Tdp1 UTSW 12 99898329 missense probably damaging 1.00
R4211:Tdp1 UTSW 12 99898329 missense probably damaging 1.00
R4509:Tdp1 UTSW 12 99955065 utr 3 prime probably benign
R4774:Tdp1 UTSW 12 99902364 missense possibly damaging 0.56
R4859:Tdp1 UTSW 12 99909811 missense probably benign 0.20
R5229:Tdp1 UTSW 12 99893660 missense probably damaging 1.00
R5348:Tdp1 UTSW 12 99915506 missense probably damaging 1.00
R5441:Tdp1 UTSW 12 99910285 missense probably damaging 1.00
R5457:Tdp1 UTSW 12 99894746 nonsense probably null
R5685:Tdp1 UTSW 12 99902352 missense possibly damaging 0.51
R6329:Tdp1 UTSW 12 99914072 missense probably benign 0.02
R7060:Tdp1 UTSW 12 99911688 missense probably benign 0.02
R7066:Tdp1 UTSW 12 99894732 missense probably benign
R7479:Tdp1 UTSW 12 99891395 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTAACGTAAGCATAGGTGG -3'
(R):5'- GCCAACAGAGATAAATTTTACTCCG -3'

Sequencing Primer
(F):5'- ACGTAAGCATAGGTGGATTTTTCAG -3'
(R):5'- TTACTCCGGTACTAAAAACCTATTCC -3'
Posted On2018-04-02