Incidental Mutation 'R6329:Wnt5a'
ID509423
Institutional Source Beutler Lab
Gene Symbol Wnt5a
Ensembl Gene ENSMUSG00000021994
Gene Namewingless-type MMTV integration site family, member 5A
Synonyms8030457G12Rik, Wnt-5a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6329 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location28504750-28527448 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 28518492 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 180 (R180*)
Ref Sequence ENSEMBL: ENSMUSP00000107891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063465] [ENSMUST00000112272]
Predicted Effect probably null
Transcript: ENSMUST00000063465
AA Change: R200*
SMART Domains Protein: ENSMUSP00000064878
Gene: ENSMUSG00000021994
AA Change: R200*

DomainStartEndE-ValueType
Blast:WNT1 1 46 7e-6 BLAST
WNT1 71 380 6.71e-222 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112272
AA Change: R180*
SMART Domains Protein: ENSMUSP00000107891
Gene: ENSMUSG00000021994
AA Change: R180*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WNT1 51 360 6.71e-222 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134163
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants exhibit caudal truncation with shortened anterior-posterior axis, truncation of the snout, tongue and mandible, short fore- and hindlimbs, which lack digits, absent genital tubercle and lung abnormalities. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,173,696 H72R probably damaging Het
Abca13 A T 11: 9,277,937 N660I probably damaging Het
Actr8 C T 14: 29,993,084 R619* probably null Het
Adam18 C A 8: 24,614,827 G657V probably damaging Het
Adcyap1 A G 17: 93,202,799 E85G probably benign Het
Akr1c14 A G 13: 4,087,302 Y305C probably damaging Het
Ankdd1b T A 13: 96,454,880 H37L possibly damaging Het
Ap4e1 T C 2: 127,061,716 L846P probably benign Het
Aqp9 A T 9: 71,132,684 Y105* probably null Het
Arid1b C T 17: 5,337,263 Q1664* probably null Het
Aup1 A G 6: 83,054,607 probably benign Het
Bnip1 C A 17: 26,786,710 S64* probably null Het
Calcr T A 6: 3,687,621 Q422L probably damaging Het
Ccdc162 T A 10: 41,663,151 D407V possibly damaging Het
Ccdc66 G T 14: 27,486,484 S760R probably benign Het
Cd22 T A 7: 30,877,768 E38V probably damaging Het
Cggbp1 T C 16: 64,856,020 Y150H probably damaging Het
Chd3 T C 11: 69,361,684 K263R possibly damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a2 T C 10: 76,599,828 T858A probably benign Het
Dnah7a T A 1: 53,541,114 D1554V probably damaging Het
Dnajc25 A T 4: 59,013,678 Q132L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Ehbp1l1 A C 19: 5,718,767 I836S possibly damaging Het
Elf1 A G 14: 79,573,339 Q288R possibly damaging Het
Fbn1 C A 2: 125,308,473 V2608L possibly damaging Het
Frmpd1 T C 4: 45,268,551 I232T possibly damaging Het
Fuca1 T A 4: 135,934,826 I355N probably damaging Het
Gcnt4 A G 13: 96,947,273 D359G probably damaging Het
Gm15448 T C 7: 3,822,851 T340A probably damaging Het
Gm5134 T C 10: 75,954,660 M30T possibly damaging Het
Grk1 T G 8: 13,405,704 L196R probably damaging Het
Igkv14-126 A C 6: 67,896,564 D92A probably damaging Het
Kmt2c A G 5: 25,315,602 S1837P probably benign Het
Lhx4 T A 1: 155,702,554 T281S probably benign Het
Lrrc55 G T 2: 85,196,309 H124N probably benign Het
March8 T A 6: 116,406,316 I566N possibly damaging Het
Mycbp2 G A 14: 103,155,852 A3091V probably benign Het
Nlrp4b A G 7: 10,724,920 N355S probably benign Het
Nmur2 A G 11: 56,029,585 V278A probably benign Het
Nod1 T C 6: 54,944,704 M210V probably benign Het
Nt5c1b T A 12: 10,372,138 C63* probably null Het
Olfr1164 G A 2: 88,093,664 P91S probably damaging Het
Olfr1288 C T 2: 111,479,228 A148V possibly damaging Het
Olfr346 A T 2: 36,688,682 K227* probably null Het
Olfr397 A G 11: 73,964,742 I45V possibly damaging Het
Olfr836 A C 9: 19,120,957 M1L probably benign Het
Olfr884 T C 9: 38,047,825 V201A probably benign Het
Olfr938 C T 9: 39,077,903 V281I probably benign Het
Osbp2 T A 11: 3,715,153 S517C probably damaging Het
Pcdha1 C T 18: 36,932,248 P655L probably damaging Het
Pdcd6 A G 13: 74,303,979 Y181H probably damaging Het
Perp G A 10: 18,855,754 G154S probably damaging Het
Perp G T 10: 18,855,755 G154V probably damaging Het
Prokr1 T G 6: 87,581,792 T204P possibly damaging Het
Prpf3 A T 3: 95,832,578 C630S probably damaging Het
Pter C A 2: 12,980,548 H230N probably damaging Het
Ptprs A T 17: 56,417,427 Y1167* probably null Het
Rad54l2 T C 9: 106,717,922 I279V possibly damaging Het
Rora T A 9: 69,373,186 L347Q probably damaging Het
Runx1t1 T G 4: 13,785,136 M1R probably null Het
Sdcbp A G 4: 6,381,064 S70G probably benign Het
Serpinb12 A G 1: 106,953,763 Y210C probably damaging Het
Sipa1 T C 19: 5,651,489 E1015G probably damaging Het
Slc15a2 A C 16: 36,751,782 L740R possibly damaging Het
Specc1 A G 11: 62,156,553 E916G probably damaging Het
Spta1 T C 1: 174,214,177 I1371T possibly damaging Het
Tagln3 T C 16: 45,713,002 M130V probably benign Het
Tchh A T 3: 93,446,445 E1064V unknown Het
Tdp1 A T 12: 99,914,071 S464C probably damaging Het
Tdp1 G C 12: 99,914,072 S464T probably benign Het
Tenm3 T C 8: 48,276,849 Y1374C probably damaging Het
Tmprss3 A T 17: 31,183,859 Y455* probably null Het
Ttc5 A G 14: 50,765,928 V433A possibly damaging Het
Zfp53 A G 17: 21,508,110 D135G probably benign Het
Zfp619 T A 7: 39,537,545 C1000S probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Wnt5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Wnt5a APN 14 28522909 missense probably damaging 1.00
IGL01945:Wnt5a APN 14 28518562 missense probably damaging 1.00
IGL02117:Wnt5a APN 14 28506120 splice site probably benign
IGL02995:Wnt5a APN 14 28522914 missense probably benign 0.02
IGL03123:Wnt5a APN 14 28522925 missense probably damaging 1.00
Thrush UTSW 14 28518463 missense possibly damaging 0.78
R0254:Wnt5a UTSW 14 28522854 missense probably damaging 1.00
R0277:Wnt5a UTSW 14 28513268 missense possibly damaging 0.74
R0365:Wnt5a UTSW 14 28518504 nonsense probably null
R1472:Wnt5a UTSW 14 28518504 nonsense probably null
R1661:Wnt5a UTSW 14 28518343 missense probably benign 0.02
R1662:Wnt5a UTSW 14 28518343 missense probably benign 0.02
R1762:Wnt5a UTSW 14 28522891 missense probably damaging 1.00
R1791:Wnt5a UTSW 14 28511878 start codon destroyed probably null 0.00
R1933:Wnt5a UTSW 14 28511845 missense probably benign 0.00
R2147:Wnt5a UTSW 14 28513317 missense probably damaging 1.00
R2149:Wnt5a UTSW 14 28513317 missense probably damaging 1.00
R3078:Wnt5a UTSW 14 28513183 nonsense probably null
R3162:Wnt5a UTSW 14 28522488 missense probably benign 0.00
R3162:Wnt5a UTSW 14 28522488 missense probably benign 0.00
R4237:Wnt5a UTSW 14 28522866 missense probably damaging 1.00
R5396:Wnt5a UTSW 14 28522770 missense probably damaging 1.00
R6698:Wnt5a UTSW 14 28518463 missense possibly damaging 0.78
R6974:Wnt5a UTSW 14 28522570 missense possibly damaging 0.89
R7114:Wnt5a UTSW 14 28522756 missense probably damaging 1.00
R7232:Wnt5a UTSW 14 28518372 missense probably benign 0.03
R7457:Wnt5a UTSW 14 28518279 splice site probably null
R7666:Wnt5a UTSW 14 28518372 missense possibly damaging 0.88
R8273:Wnt5a UTSW 14 28522605 missense probably damaging 1.00
T0722:Wnt5a UTSW 14 28511925 missense probably benign 0.01
Z1088:Wnt5a UTSW 14 28522728 missense probably damaging 0.99
Z1176:Wnt5a UTSW 14 28511907 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATCCTTAATCGCAGGCAG -3'
(R):5'- TATCCGGAGAGACCTGAACTG -3'

Sequencing Primer
(F):5'- TTAATCGCAGGCAGCCGAG -3'
(R):5'- AGGACCCAACTCCTGTGTGTG -3'
Posted On2018-04-02