Mutagenetix > Incidental Mutations

Incidental Mutation 'R6329:Ptprs'

509436

Institutional Source

Beutler Lab

Gene Symbol

Ptprs

Ensembl Gene

ENSMUSG00000013236

Gene Name

protein tyrosine phosphatase, receptor type, S

Synonyms

Ptpt9, PTP-NU3, RPTPsigma, PTPsigma

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6329 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

56412426-56476483 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 56417427 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1167 (Y1167*)

Ref Sequence

ENSEMBL: ENSMUSP00000153134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223859]

Predicted Effect

probably null
Transcript: ENSMUST00000067538
AA Change: Y1577*

SMART Domains

Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: Y1577*

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
IGc2	45	114	3.38e-10	SMART
IGc2	147	214	2.4e-15	SMART
IGc2	244	305	8.26e-5	SMART
FN3	319	398	2.8e-14	SMART
FN3	414	497	3.24e-10	SMART
FN3	512	590	3.17e-13	SMART
FN3	605	692	9.69e-9	SMART
FN3	707	796	2.42e-9	SMART
FN3	811	890	2.22e0	SMART
FN3	905	995	8.31e-8	SMART
FN3	1009	1085	3.22e-5	SMART
low complexity region	1164	1177	N/A	INTRINSIC
transmembrane domain	1259	1281	N/A	INTRINSIC
PTPc	1351	1609	1.54e-136	SMART
PTPc	1638	1900	3.12e-128	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000086828
AA Change: Y1171*

SMART Domains

Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: Y1171*

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
IGc2	45	114	3.38e-10	SMART
IGc2	147	214	2.4e-15	SMART
IGc2	244	305	8.26e-5	SMART
FN3	319	398	2.8e-14	SMART
FN3	414	497	3.24e-10	SMART
FN3	512	590	3.17e-13	SMART
FN3	603	679	2.54e-3	SMART
low complexity region	758	771	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
PTPc	945	1203	1.54e-136	SMART
PTPc	1232	1494	3.12e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143018

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184960

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223685

Predicted Effect

probably null
Transcript: ENSMUST00000223859
AA Change: Y1167*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224522

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225379

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	T	C	3: 138,173,696	H72R	probably damaging	Het
Abca13	A	T	11: 9,277,937	N660I	probably damaging	Het
Actr8	C	T	14: 29,993,084	R619*	probably null	Het
Adam18	C	A	8: 24,614,827	G657V	probably damaging	Het
Adcyap1	A	G	17: 93,202,799	E85G	probably benign	Het
Akr1c14	A	G	13: 4,087,302	Y305C	probably damaging	Het
Ankdd1b	T	A	13: 96,454,880	H37L	possibly damaging	Het
Ap4e1	T	C	2: 127,061,716	L846P	probably benign	Het
Aqp9	A	T	9: 71,132,684	Y105*	probably null	Het
Arid1b	C	T	17: 5,337,263	Q1664*	probably null	Het
Aup1	A	G	6: 83,054,607		probably benign	Het
Bnip1	C	A	17: 26,786,710	S64*	probably null	Het
Calcr	T	A	6: 3,687,621	Q422L	probably damaging	Het
Ccdc162	T	A	10: 41,663,151	D407V	possibly damaging	Het
Ccdc66	G	T	14: 27,486,484	S760R	probably benign	Het
Cd22	T	A	7: 30,877,768	E38V	probably damaging	Het
Cggbp1	T	C	16: 64,856,020	Y150H	probably damaging	Het
Chd3	T	C	11: 69,361,684	K263R	possibly damaging	Het
Col4a2	T	A	8: 11,446,238	F1620I	probably damaging	Het
Col6a2	T	C	10: 76,599,828	T858A	probably benign	Het
Dnah7a	T	A	1: 53,541,114	D1554V	probably damaging	Het
Dnajc25	A	T	4: 59,013,678	Q132L	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Ehbp1l1	A	C	19: 5,718,767	I836S	possibly damaging	Het
Elf1	A	G	14: 79,573,339	Q288R	possibly damaging	Het
Fbn1	C	A	2: 125,308,473	V2608L	possibly damaging	Het
Frmpd1	T	C	4: 45,268,551	I232T	possibly damaging	Het
Fuca1	T	A	4: 135,934,826	I355N	probably damaging	Het
Gcnt4	A	G	13: 96,947,273	D359G	probably damaging	Het
Gm15448	T	C	7: 3,822,851	T340A	probably damaging	Het
Gm5134	T	C	10: 75,954,660	M30T	possibly damaging	Het
Grk1	T	G	8: 13,405,704	L196R	probably damaging	Het
Igkv14-126	A	C	6: 67,896,564	D92A	probably damaging	Het
Kmt2c	A	G	5: 25,315,602	S1837P	probably benign	Het
Lhx4	T	A	1: 155,702,554	T281S	probably benign	Het
Lrrc55	G	T	2: 85,196,309	H124N	probably benign	Het
March8	T	A	6: 116,406,316	I566N	possibly damaging	Het
Mycbp2	G	A	14: 103,155,852	A3091V	probably benign	Het
Nlrp4b	A	G	7: 10,724,920	N355S	probably benign	Het
Nmur2	A	G	11: 56,029,585	V278A	probably benign	Het
Nod1	T	C	6: 54,944,704	M210V	probably benign	Het
Nt5c1b	T	A	12: 10,372,138	C63*	probably null	Het
Olfr1164	G	A	2: 88,093,664	P91S	probably damaging	Het
Olfr1288	C	T	2: 111,479,228	A148V	possibly damaging	Het
Olfr346	A	T	2: 36,688,682	K227*	probably null	Het
Olfr397	A	G	11: 73,964,742	I45V	possibly damaging	Het
Olfr836	A	C	9: 19,120,957	M1L	probably benign	Het
Olfr884	T	C	9: 38,047,825	V201A	probably benign	Het
Olfr938	C	T	9: 39,077,903	V281I	probably benign	Het
Osbp2	T	A	11: 3,715,153	S517C	probably damaging	Het
Pcdha1	C	T	18: 36,932,248	P655L	probably damaging	Het
Pdcd6	A	G	13: 74,303,979	Y181H	probably damaging	Het
Perp	G	A	10: 18,855,754	G154S	probably damaging	Het
Perp	G	T	10: 18,855,755	G154V	probably damaging	Het
Prokr1	T	G	6: 87,581,792	T204P	possibly damaging	Het
Prpf3	A	T	3: 95,832,578	C630S	probably damaging	Het
Pter	C	A	2: 12,980,548	H230N	probably damaging	Het
Rad54l2	T	C	9: 106,717,922	I279V	possibly damaging	Het
Rora	T	A	9: 69,373,186	L347Q	probably damaging	Het
Runx1t1	T	G	4: 13,785,136	M1R	probably null	Het
Sdcbp	A	G	4: 6,381,064	S70G	probably benign	Het
Serpinb12	A	G	1: 106,953,763	Y210C	probably damaging	Het
Sipa1	T	C	19: 5,651,489	E1015G	probably damaging	Het
Slc15a2	A	C	16: 36,751,782	L740R	possibly damaging	Het
Specc1	A	G	11: 62,156,553	E916G	probably damaging	Het
Spta1	T	C	1: 174,214,177	I1371T	possibly damaging	Het
Tagln3	T	C	16: 45,713,002	M130V	probably benign	Het
Tchh	A	T	3: 93,446,445	E1064V	unknown	Het
Tdp1	A	T	12: 99,914,071	S464C	probably damaging	Het
Tdp1	G	C	12: 99,914,072	S464T	probably benign	Het
Tenm3	T	C	8: 48,276,849	Y1374C	probably damaging	Het
Tmprss3	A	T	17: 31,183,859	Y455*	probably null	Het
Ttc5	A	G	14: 50,765,928	V433A	possibly damaging	Het
Wnt5a	A	T	14: 28,518,492	R180*	probably null	Het
Zfp53	A	G	17: 21,508,110	D135G	probably benign	Het
Zfp619	T	A	7: 39,537,545	C1000S	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Ptprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Ptprs	APN	17	56458243	missense	probably damaging	0.99
IGL01388:Ptprs	APN	17	56421261	missense	probably damaging	1.00
IGL01568:Ptprs	APN	17	56413958	missense	probably damaging	1.00
IGL01781:Ptprs	APN	17	56435676	missense	probably damaging	1.00
IGL02499:Ptprs	APN	17	56437884	missense	probably damaging	1.00
IGL02576:Ptprs	APN	17	56414958	missense	probably damaging	1.00
IGL02736:Ptprs	APN	17	56458248	missense	possibly damaging	0.88
IGL02871:Ptprs	APN	17	56447443	missense	probably damaging	1.00
IGL02946:Ptprs	APN	17	56424032	missense	probably benign
IGL03061:Ptprs	APN	17	56418830	missense	probably damaging	0.96
IGL03347:Ptprs	APN	17	56435972	missense	probably benign	0.07
IGL03351:Ptprs	APN	17	56437943	missense	probably damaging	1.00
P0019:Ptprs	UTSW	17	56447474	splice site	probably benign
PIT4434001:Ptprs	UTSW	17	56454984	missense	probably null	0.02
PIT4520001:Ptprs	UTSW	17	56414980	missense	probably damaging	1.00
R0240:Ptprs	UTSW	17	56436087	splice site	probably null
R0240:Ptprs	UTSW	17	56436087	splice site	probably null
R0504:Ptprs	UTSW	17	56454220	missense	possibly damaging	0.60
R0518:Ptprs	UTSW	17	56419621	critical splice donor site	probably null
R0539:Ptprs	UTSW	17	56458255	missense	probably damaging	0.97
R0620:Ptprs	UTSW	17	56429103	missense	possibly damaging	0.93
R0683:Ptprs	UTSW	17	56414086	missense	probably damaging	1.00
R1147:Ptprs	UTSW	17	56423504	missense	probably damaging	1.00
R1147:Ptprs	UTSW	17	56423504	missense	probably damaging	1.00
R1474:Ptprs	UTSW	17	56424128	missense	probably damaging	0.98
R1502:Ptprs	UTSW	17	56437992	missense	probably benign	0.00
R1817:Ptprs	UTSW	17	56419527	missense	probably damaging	1.00
R1844:Ptprs	UTSW	17	56434510	missense	probably damaging	1.00
R2077:Ptprs	UTSW	17	56434990	missense	probably null	0.26
R2086:Ptprs	UTSW	17	56454984	missense	probably null	0.02
R2149:Ptprs	UTSW	17	56417706	missense	probably damaging	1.00
R3618:Ptprs	UTSW	17	56428965	missense	probably benign	0.25
R3722:Ptprs	UTSW	17	56417485	missense	probably damaging	1.00
R3771:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R3772:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R3773:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R4032:Ptprs	UTSW	17	56413386	missense	probably damaging	1.00
R4326:Ptprs	UTSW	17	56447468	missense	possibly damaging	0.83
R4327:Ptprs	UTSW	17	56447468	missense	possibly damaging	0.83
R4480:Ptprs	UTSW	17	56426404	missense	possibly damaging	0.79
R4505:Ptprs	UTSW	17	56451678	missense	possibly damaging	0.57
R4507:Ptprs	UTSW	17	56419014	missense	probably damaging	1.00
R4588:Ptprs	UTSW	17	56425534	missense	probably damaging	1.00
R4662:Ptprs	UTSW	17	56417666	missense	probably damaging	1.00
R4708:Ptprs	UTSW	17	56428067	missense	probably damaging	1.00
R5016:Ptprs	UTSW	17	56419070	missense	probably damaging	1.00
R5416:Ptprs	UTSW	17	56435724	missense	probably damaging	1.00
R5447:Ptprs	UTSW	17	56429128	missense	possibly damaging	0.50
R6041:Ptprs	UTSW	17	56419080	missense	probably benign	0.00
R6377:Ptprs	UTSW	17	56418935	missense	probably damaging	1.00
R6605:Ptprs	UTSW	17	56422195	missense	probably damaging	1.00
R6749:Ptprs	UTSW	17	56437884	missense	probably damaging	1.00
R7113:Ptprs	UTSW	17	56451697	missense	probably benign	0.40
R7114:Ptprs	UTSW	17	56451697	missense	probably benign	0.40
R7133:Ptprs	UTSW	17	56417429	missense	probably damaging	1.00
R7220:Ptprs	UTSW	17	56418988	missense	probably benign	0.29
R7423:Ptprs	UTSW	17	56414793	missense	probably damaging	1.00
R7440:Ptprs	UTSW	17	56424256	missense	possibly damaging	0.75
R7457:Ptprs	UTSW	17	56419502	missense	probably damaging	0.99
R7574:Ptprs	UTSW	17	56423538	missense	probably benign	0.00
R7851:Ptprs	UTSW	17	56425482	missense	probably benign
R7903:Ptprs	UTSW	17	56424960	nonsense	probably null
R8013:Ptprs	UTSW	17	56435994	missense	probably damaging	1.00
R8014:Ptprs	UTSW	17	56435994	missense	probably damaging	1.00
R8094:Ptprs	UTSW	17	56428947	missense	probably benign	0.01
R8112:Ptprs	UTSW	17	56434532	nonsense	probably null
R8181:Ptprs	UTSW	17	56429064	missense	probably damaging	1.00
R8511:Ptprs	UTSW	17	56447440	missense	probably damaging	1.00
RF014:Ptprs	UTSW	17	56416935	missense	probably damaging	1.00
X0028:Ptprs	UTSW	17	56437831	missense	probably damaging	1.00
Z1176:Ptprs	UTSW	17	56417050	missense	possibly damaging	0.82
Z1176:Ptprs	UTSW	17	56422211	nonsense	probably null
Z1176:Ptprs	UTSW	17	56434468	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- GCAACAAAATCACCGGCATGTG -3'
(R):5'- CTGCGAAGAGTCAAGACCTG -3'

Sequencing Primer
(F):5'- ACTGTGGGAGTCAGTTTTCACACC -3'
(R):5'- CCATTGTGGTCCACTGCAG -3'

Posted On

2018-04-02