Incidental Mutation 'R6329:Ehbp1l1'
ID509440
Institutional Source Beutler Lab
Gene Symbol Ehbp1l1
Ensembl Gene ENSMUSG00000024937
Gene NameEH domain binding protein 1-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6329 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5707376-5726317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 5718767 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 836 (I836S)
Ref Sequence ENSEMBL: ENSMUSP00000037656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049295] [ENSMUST00000075606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049295
AA Change: I836S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937
AA Change: I836S

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075606
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout leads to a reduction in the length and density of small intestinal microvilli, severe anemia, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,173,696 H72R probably damaging Het
Abca13 A T 11: 9,277,937 N660I probably damaging Het
Actr8 C T 14: 29,993,084 R619* probably null Het
Adam18 C A 8: 24,614,827 G657V probably damaging Het
Adcyap1 A G 17: 93,202,799 E85G probably benign Het
Akr1c14 A G 13: 4,087,302 Y305C probably damaging Het
Ankdd1b T A 13: 96,454,880 H37L possibly damaging Het
Ap4e1 T C 2: 127,061,716 L846P probably benign Het
Aqp9 A T 9: 71,132,684 Y105* probably null Het
Arid1b C T 17: 5,337,263 Q1664* probably null Het
Aup1 A G 6: 83,054,607 probably benign Het
Bnip1 C A 17: 26,786,710 S64* probably null Het
Calcr T A 6: 3,687,621 Q422L probably damaging Het
Ccdc162 T A 10: 41,663,151 D407V possibly damaging Het
Ccdc66 G T 14: 27,486,484 S760R probably benign Het
Cd22 T A 7: 30,877,768 E38V probably damaging Het
Cggbp1 T C 16: 64,856,020 Y150H probably damaging Het
Chd3 T C 11: 69,361,684 K263R possibly damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a2 T C 10: 76,599,828 T858A probably benign Het
Dnah7a T A 1: 53,541,114 D1554V probably damaging Het
Dnajc25 A T 4: 59,013,678 Q132L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elf1 A G 14: 79,573,339 Q288R possibly damaging Het
Fbn1 C A 2: 125,308,473 V2608L possibly damaging Het
Frmpd1 T C 4: 45,268,551 I232T possibly damaging Het
Fuca1 T A 4: 135,934,826 I355N probably damaging Het
Gcnt4 A G 13: 96,947,273 D359G probably damaging Het
Gm15448 T C 7: 3,822,851 T340A probably damaging Het
Gm5134 T C 10: 75,954,660 M30T possibly damaging Het
Grk1 T G 8: 13,405,704 L196R probably damaging Het
Igkv14-126 A C 6: 67,896,564 D92A probably damaging Het
Kmt2c A G 5: 25,315,602 S1837P probably benign Het
Lhx4 T A 1: 155,702,554 T281S probably benign Het
Lrrc55 G T 2: 85,196,309 H124N probably benign Het
March8 T A 6: 116,406,316 I566N possibly damaging Het
Mycbp2 G A 14: 103,155,852 A3091V probably benign Het
Nlrp4b A G 7: 10,724,920 N355S probably benign Het
Nmur2 A G 11: 56,029,585 V278A probably benign Het
Nod1 T C 6: 54,944,704 M210V probably benign Het
Nt5c1b T A 12: 10,372,138 C63* probably null Het
Olfr1164 G A 2: 88,093,664 P91S probably damaging Het
Olfr1288 C T 2: 111,479,228 A148V possibly damaging Het
Olfr346 A T 2: 36,688,682 K227* probably null Het
Olfr397 A G 11: 73,964,742 I45V possibly damaging Het
Olfr836 A C 9: 19,120,957 M1L probably benign Het
Olfr884 T C 9: 38,047,825 V201A probably benign Het
Olfr938 C T 9: 39,077,903 V281I probably benign Het
Osbp2 T A 11: 3,715,153 S517C probably damaging Het
Pcdha1 C T 18: 36,932,248 P655L probably damaging Het
Pdcd6 A G 13: 74,303,979 Y181H probably damaging Het
Perp G A 10: 18,855,754 G154S probably damaging Het
Perp G T 10: 18,855,755 G154V probably damaging Het
Prokr1 T G 6: 87,581,792 T204P possibly damaging Het
Prpf3 A T 3: 95,832,578 C630S probably damaging Het
Pter C A 2: 12,980,548 H230N probably damaging Het
Ptprs A T 17: 56,417,427 Y1167* probably null Het
Rad54l2 T C 9: 106,717,922 I279V possibly damaging Het
Rora T A 9: 69,373,186 L347Q probably damaging Het
Runx1t1 T G 4: 13,785,136 M1R probably null Het
Sdcbp A G 4: 6,381,064 S70G probably benign Het
Serpinb12 A G 1: 106,953,763 Y210C probably damaging Het
Sipa1 T C 19: 5,651,489 E1015G probably damaging Het
Slc15a2 A C 16: 36,751,782 L740R possibly damaging Het
Specc1 A G 11: 62,156,553 E916G probably damaging Het
Spta1 T C 1: 174,214,177 I1371T possibly damaging Het
Tagln3 T C 16: 45,713,002 M130V probably benign Het
Tchh A T 3: 93,446,445 E1064V unknown Het
Tdp1 A T 12: 99,914,071 S464C probably damaging Het
Tdp1 G C 12: 99,914,072 S464T probably benign Het
Tenm3 T C 8: 48,276,849 Y1374C probably damaging Het
Tmprss3 A T 17: 31,183,859 Y455* probably null Het
Ttc5 A G 14: 50,765,928 V433A possibly damaging Het
Wnt5a A T 14: 28,518,492 R180* probably null Het
Zfp53 A G 17: 21,508,110 D135G probably benign Het
Zfp619 T A 7: 39,537,545 C1000S probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Ehbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Ehbp1l1 APN 19 5717933 missense probably benign 0.33
IGL01061:Ehbp1l1 APN 19 5717888 missense probably benign
IGL01372:Ehbp1l1 APN 19 5715789 splice site probably benign
IGL01790:Ehbp1l1 APN 19 5722984 missense probably damaging 0.99
IGL01936:Ehbp1l1 APN 19 5718249 nonsense probably null
IGL02194:Ehbp1l1 APN 19 5718857 missense probably benign
IGL02347:Ehbp1l1 APN 19 5719572 missense possibly damaging 0.72
IGL02372:Ehbp1l1 APN 19 5710834 missense possibly damaging 0.53
IGL02681:Ehbp1l1 APN 19 5720825 missense probably damaging 0.98
IGL02824:Ehbp1l1 APN 19 5719298 missense probably benign
IGL03070:Ehbp1l1 APN 19 5715953 missense probably benign 0.33
IGL03146:Ehbp1l1 APN 19 5720033 missense probably benign 0.00
PIT4802001:Ehbp1l1 UTSW 19 5719575 missense possibly damaging 0.93
R0309:Ehbp1l1 UTSW 19 5720570 missense possibly damaging 0.72
R0787:Ehbp1l1 UTSW 19 5722668 missense possibly damaging 0.95
R1156:Ehbp1l1 UTSW 19 5708336 unclassified probably benign
R1337:Ehbp1l1 UTSW 19 5718230 missense probably benign 0.00
R1474:Ehbp1l1 UTSW 19 5719084 missense possibly damaging 0.86
R1501:Ehbp1l1 UTSW 19 5716424 missense probably damaging 0.98
R1582:Ehbp1l1 UTSW 19 5721967 missense possibly damaging 0.83
R1766:Ehbp1l1 UTSW 19 5716406 missense probably damaging 0.98
R1838:Ehbp1l1 UTSW 19 5717691 missense probably benign 0.39
R1842:Ehbp1l1 UTSW 19 5725930 missense probably damaging 0.99
R1863:Ehbp1l1 UTSW 19 5717854 missense probably benign 0.01
R1955:Ehbp1l1 UTSW 19 5710669 missense possibly damaging 0.51
R2010:Ehbp1l1 UTSW 19 5719283 missense probably benign
R2098:Ehbp1l1 UTSW 19 5708658 missense possibly damaging 0.93
R2099:Ehbp1l1 UTSW 19 5718401 missense possibly damaging 0.72
R2852:Ehbp1l1 UTSW 19 5716487 missense probably damaging 0.99
R3113:Ehbp1l1 UTSW 19 5718980 missense probably benign 0.38
R3799:Ehbp1l1 UTSW 19 5719115 missense probably benign 0.33
R3891:Ehbp1l1 UTSW 19 5718312 missense possibly damaging 0.73
R3964:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R3966:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R4335:Ehbp1l1 UTSW 19 5708769 missense probably damaging 0.98
R4434:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R4457:Ehbp1l1 UTSW 19 5716293 missense possibly damaging 0.83
R4597:Ehbp1l1 UTSW 19 5717927 missense possibly damaging 0.72
R4726:Ehbp1l1 UTSW 19 5719176 missense possibly damaging 0.70
R4761:Ehbp1l1 UTSW 19 5719847 missense possibly damaging 0.93
R4771:Ehbp1l1 UTSW 19 5725968 missense probably damaging 1.00
R5402:Ehbp1l1 UTSW 19 5716320 missense possibly damaging 0.91
R5436:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R5602:Ehbp1l1 UTSW 19 5708670 missense possibly damaging 0.85
R5893:Ehbp1l1 UTSW 19 5718431 missense probably benign
R6416:Ehbp1l1 UTSW 19 5718757 missense probably benign 0.01
R7106:Ehbp1l1 UTSW 19 5718737 missense probably benign 0.33
R7262:Ehbp1l1 UTSW 19 5718446 nonsense probably null
R7304:Ehbp1l1 UTSW 19 5716382 missense probably damaging 1.00
R7317:Ehbp1l1 UTSW 19 5720702 missense probably benign 0.44
R7404:Ehbp1l1 UTSW 19 5720844 missense possibly damaging 0.72
R7447:Ehbp1l1 UTSW 19 5719428 missense possibly damaging 0.53
R7862:Ehbp1l1 UTSW 19 5720823 missense probably benign
R7881:Ehbp1l1 UTSW 19 5719398 missense probably benign
R7910:Ehbp1l1 UTSW 19 5716424 missense probably benign 0.28
R8239:Ehbp1l1 UTSW 19 5720061 missense possibly damaging 0.53
R8309:Ehbp1l1 UTSW 19 5717075 missense probably damaging 1.00
R8324:Ehbp1l1 UTSW 19 5719998 missense possibly damaging 0.86
RF053:Ehbp1l1 UTSW 19 5716002 small deletion probably benign
Z1088:Ehbp1l1 UTSW 19 5716287 missense possibly damaging 0.77
Z1176:Ehbp1l1 UTSW 19 5717889 missense probably benign
Z1177:Ehbp1l1 UTSW 19 5718762 missense probably damaging 0.99
Z1177:Ehbp1l1 UTSW 19 5719101 missense probably benign 0.07
Z1177:Ehbp1l1 UTSW 19 5719102 missense probably benign 0.01
Z1177:Ehbp1l1 UTSW 19 5719434 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCCTAAGAGCTCAGATTCTGG -3'
(R):5'- CCAGGAGACCGATGTTTCAG -3'

Sequencing Primer
(F):5'- GTAGGTTGGCCACTACTCTCAG -3'
(R):5'- ACCGATGTTTCAGTGATGGAGAC -3'
Posted On2018-04-02