Incidental Mutation 'R6307:Scn3a'
ID509446
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6307 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65472341 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1254 (S1254P)
Ref Sequence ENSEMBL: ENSMUSP00000097647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect probably damaging
Transcript: ENSMUST00000066432
AA Change: S1254P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: S1254P

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100069
AA Change: S1254P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: S1254P

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Meta Mutation Damage Score 0.8957 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,007,387 L1232P probably damaging Het
Akap6 A T 12: 53,141,568 I1922F possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arpc5 T C 1: 152,771,455 V103A possibly damaging Het
Atp9a C A 2: 168,668,170 V430F probably benign Het
Bod1 A G 11: 31,666,932 S110P probably damaging Het
Cacna1c C A 6: 118,613,953 V1453F probably damaging Het
Capn8 T A 1: 182,607,699 M414K probably damaging Het
Cbl A T 9: 44,158,512 probably null Het
Ccdc42 A T 11: 68,588,280 Q98L probably damaging Het
Cd200 C A 16: 45,397,182 V49L probably benign Het
Celsr1 A G 15: 85,928,330 S2060P probably benign Het
Ces1g A T 8: 93,331,192 H160Q possibly damaging Het
Chrnb2 G T 3: 89,761,524 H161Q probably damaging Het
Ctns G A 11: 73,191,733 T57I probably benign Het
Cyp3a25 A T 5: 145,994,956 M114K possibly damaging Het
D630003M21Rik A G 2: 158,215,951 F536L probably benign Het
Dcc C T 18: 71,810,755 R275Q probably benign Het
Dmxl2 A T 9: 54,382,706 H2508Q possibly damaging Het
Elf5 C A 2: 103,439,412 Q113K probably damaging Het
Fam83a T G 15: 57,986,111 V17G possibly damaging Het
Farsa T C 8: 84,861,045 probably null Het
Fat2 G C 11: 55,281,280 T2869S possibly damaging Het
Fgg A T 3: 83,012,976 Q354L probably damaging Het
Folh1 T C 7: 86,723,309 D679G probably damaging Het
Gbp4 T A 5: 105,123,109 R83* probably null Het
Gm17482 T A 6: 115,227,350 probably benign Het
Hmgxb4 T A 8: 75,023,299 V481D possibly damaging Het
Ifi207 A C 1: 173,725,053 Y926D probably damaging Het
Ikzf5 T A 7: 131,391,648 N264Y probably damaging Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Krt33b A T 11: 100,024,868 C351S probably benign Het
Lrp1 T C 10: 127,592,075 D543G probably damaging Het
Lrrfip2 C T 9: 111,223,953 R339W probably damaging Het
Mapk3 T G 7: 126,764,282 M276R probably benign Het
Mgst1 T C 6: 138,150,829 V137A probably benign Het
Muc16 T C 9: 18,647,588 T2470A unknown Het
Muc4 C T 16: 32,753,946 S1274F possibly damaging Het
Myo5c A C 9: 75,272,916 K713T possibly damaging Het
Myzap T C 9: 71,558,864 D170G possibly damaging Het
Naa50 T C 16: 44,159,468 V113A probably damaging Het
Neu3 T C 7: 99,813,722 T265A probably benign Het
Nin T C 12: 70,014,857 T2078A possibly damaging Het
Nomo1 G A 7: 46,033,836 probably benign Het
Nov T C 15: 54,748,025 probably null Het
Nprl3 A G 11: 32,239,828 L273P probably damaging Het
Oaf T A 9: 43,224,919 H120L possibly damaging Het
Olfr1053 T C 2: 86,315,124 H54R probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr982 T C 9: 40,074,528 S78P probably damaging Het
Pcdhga3 T A 18: 37,676,621 probably benign Het
Polq G A 16: 37,017,356 probably null Het
Prdm8 C T 5: 98,185,303 P243L possibly damaging Het
Prim2 T C 1: 33,662,292 D138G probably benign Het
Prl2c5 A G 13: 13,190,590 E107G probably benign Het
Prr14l T A 5: 32,827,525 H1542L probably damaging Het
Rab26 T C 17: 24,530,098 E203G probably damaging Het
Rtkn2 A T 10: 68,035,832 H350L possibly damaging Het
Scara3 T C 14: 65,938,261 D19G probably benign Het
Sdcbp A G 4: 6,385,059 M93V probably benign Het
Sema6a C A 18: 47,249,164 R772L probably damaging Het
Slc5a7 T C 17: 54,276,978 K428R probably benign Het
Sptbn2 G A 19: 4,724,646 G109D probably damaging Het
Tmppe T C 9: 114,404,744 L37P probably benign Het
Tuba1a T C 15: 98,951,529 T56A probably benign Het
Vmn2r111 A G 17: 22,573,089 I62T probably benign Het
Vmn2r73 A G 7: 85,857,620 I828T probably damaging Het
Vmn2r79 T A 7: 87,037,768 W786R probably damaging Het
Zcchc11 T A 4: 108,555,620 I1506N probably damaging Het
Zp1 G A 19: 10,916,720 T405M probably null Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1822:Scn3a UTSW 2 65484372 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4918:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5730:Scn3a UTSW 2 65495260 missense probably benign 0.00
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5735:Scn3a UTSW 2 65484459 missense probably benign 0.09
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5935:Scn3a UTSW 2 65464836 missense probably damaging 1.00
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6235:Scn3a UTSW 2 65461335 missense probably damaging 0.97
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6376:Scn3a UTSW 2 65461499 missense possibly damaging 0.88
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7352:Scn3a UTSW 2 65525701 missense possibly damaging 0.51
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7733:Scn3a UTSW 2 65508650 missense probably benign 0.08
R7761:Scn3a UTSW 2 65529454 missense possibly damaging 0.95
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7967:Scn3a UTSW 2 65536515 missense probably damaging 0.96
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCAGTTTCCAGAAGAAAGG -3'
(R):5'- CAAAGAGTTCAGTGGCATGGC -3'

Sequencing Primer
(F):5'- GCTCTCTCTGACTTTAGCCCTG -3'
(R):5'- TGGCATGGCATAAGTGTTAGTAAC -3'
Posted On2018-04-02