Incidental Mutation 'R6307:Prr14l'
ID 509456
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Name proline rich 14-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R6307 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 32789820-32854256 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32827525 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 1542 (H1542L)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold E9Q7C4
Predicted Effect probably damaging
Transcript: ENSMUST00000120129
AA Change: H1542L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: H1542L

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155392
AA Change: H385L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280
AA Change: H385L

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,007,387 L1232P probably damaging Het
Akap6 A T 12: 53,141,568 I1922F possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arpc5 T C 1: 152,771,455 V103A possibly damaging Het
Atp9a C A 2: 168,668,170 V430F probably benign Het
Bod1 A G 11: 31,666,932 S110P probably damaging Het
Cacna1c C A 6: 118,613,953 V1453F probably damaging Het
Capn8 T A 1: 182,607,699 M414K probably damaging Het
Cbl A T 9: 44,158,512 probably null Het
Ccdc42 A T 11: 68,588,280 Q98L probably damaging Het
Cd200 C A 16: 45,397,182 V49L probably benign Het
Celsr1 A G 15: 85,928,330 S2060P probably benign Het
Ces1g A T 8: 93,331,192 H160Q possibly damaging Het
Chrnb2 G T 3: 89,761,524 H161Q probably damaging Het
Ctns G A 11: 73,191,733 T57I probably benign Het
Cyp3a25 A T 5: 145,994,956 M114K possibly damaging Het
D630003M21Rik A G 2: 158,215,951 F536L probably benign Het
Dcc C T 18: 71,810,755 R275Q probably benign Het
Dmxl2 A T 9: 54,382,706 H2508Q possibly damaging Het
Elf5 C A 2: 103,439,412 Q113K probably damaging Het
Fam83a T G 15: 57,986,111 V17G possibly damaging Het
Farsa T C 8: 84,861,045 probably null Het
Fat2 G C 11: 55,281,280 T2869S possibly damaging Het
Fgg A T 3: 83,012,976 Q354L probably damaging Het
Folh1 T C 7: 86,723,309 D679G probably damaging Het
Gbp4 T A 5: 105,123,109 R83* probably null Het
Gm17482 T A 6: 115,227,350 probably benign Het
Hmgxb4 T A 8: 75,023,299 V481D possibly damaging Het
Ifi207 A C 1: 173,725,053 Y926D probably damaging Het
Ikzf5 T A 7: 131,391,648 N264Y probably damaging Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Krt33b A T 11: 100,024,868 C351S probably benign Het
Lrp1 T C 10: 127,592,075 D543G probably damaging Het
Lrrfip2 C T 9: 111,223,953 R339W probably damaging Het
Mapk3 T G 7: 126,764,282 M276R probably benign Het
Mgst1 T C 6: 138,150,829 V137A probably benign Het
Muc16 T C 9: 18,647,588 T2470A unknown Het
Muc4 C T 16: 32,753,946 S1274F possibly damaging Het
Myo5c A C 9: 75,272,916 K713T possibly damaging Het
Myzap T C 9: 71,558,864 D170G possibly damaging Het
Naa50 T C 16: 44,159,468 V113A probably damaging Het
Neu3 T C 7: 99,813,722 T265A probably benign Het
Nin T C 12: 70,014,857 T2078A possibly damaging Het
Nomo1 G A 7: 46,033,836 probably benign Het
Nov T C 15: 54,748,025 probably null Het
Nprl3 A G 11: 32,239,828 L273P probably damaging Het
Oaf T A 9: 43,224,919 H120L possibly damaging Het
Olfr1053 T C 2: 86,315,124 H54R probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr982 T C 9: 40,074,528 S78P probably damaging Het
Pcdhga3 T A 18: 37,676,621 probably benign Het
Polq G A 16: 37,017,356 probably null Het
Prdm8 C T 5: 98,185,303 P243L possibly damaging Het
Prim2 T C 1: 33,662,292 D138G probably benign Het
Prl2c5 A G 13: 13,190,590 E107G probably benign Het
Rab26 T C 17: 24,530,098 E203G probably damaging Het
Rtkn2 A T 10: 68,035,832 H350L possibly damaging Het
Scara3 T C 14: 65,938,261 D19G probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Sdcbp A G 4: 6,385,059 M93V probably benign Het
Sema6a C A 18: 47,249,164 R772L probably damaging Het
Slc5a7 T C 17: 54,276,978 K428R probably benign Het
Sptbn2 G A 19: 4,724,646 G109D probably damaging Het
Tmppe T C 9: 114,404,744 L37P probably benign Het
Tuba1a T C 15: 98,951,529 T56A probably benign Het
Vmn2r111 A G 17: 22,573,089 I62T probably benign Het
Vmn2r73 A G 7: 85,857,620 I828T probably damaging Het
Vmn2r79 T A 7: 87,037,768 W786R probably damaging Het
Zcchc11 T A 4: 108,555,620 I1506N probably damaging Het
Zp1 G A 19: 10,916,720 T405M probably null Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R8071:Prr14l UTSW 5 32831164 missense probably benign 0.02
R9052:Prr14l UTSW 5 32830134 nonsense probably null
R9136:Prr14l UTSW 5 32828736 missense
Predicted Primers PCR Primer
(F):5'- GGCAGTGCCTCCATATTCTTGG -3'
(R):5'- AATGCAATGCAGCTGGACC -3'

Sequencing Primer
(F):5'- CCATATTCTTGGAGAGGAGCC -3'
(R):5'- CAATGCAGCTGGACCCATATTTGG -3'
Posted On 2018-04-02