Incidental Mutation 'R6307:Muc16'
ID 509474
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock # R6307 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 18495455-18674530 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18647588 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2470 (T2470A)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: T2470A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,007,387 L1232P probably damaging Het
Akap6 A T 12: 53,141,568 I1922F possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arpc5 T C 1: 152,771,455 V103A possibly damaging Het
Atp9a C A 2: 168,668,170 V430F probably benign Het
Bod1 A G 11: 31,666,932 S110P probably damaging Het
Cacna1c C A 6: 118,613,953 V1453F probably damaging Het
Capn8 T A 1: 182,607,699 M414K probably damaging Het
Cbl A T 9: 44,158,512 probably null Het
Ccdc42 A T 11: 68,588,280 Q98L probably damaging Het
Cd200 C A 16: 45,397,182 V49L probably benign Het
Celsr1 A G 15: 85,928,330 S2060P probably benign Het
Ces1g A T 8: 93,331,192 H160Q possibly damaging Het
Chrnb2 G T 3: 89,761,524 H161Q probably damaging Het
Ctns G A 11: 73,191,733 T57I probably benign Het
Cyp3a25 A T 5: 145,994,956 M114K possibly damaging Het
D630003M21Rik A G 2: 158,215,951 F536L probably benign Het
Dcc C T 18: 71,810,755 R275Q probably benign Het
Dmxl2 A T 9: 54,382,706 H2508Q possibly damaging Het
Elf5 C A 2: 103,439,412 Q113K probably damaging Het
Fam83a T G 15: 57,986,111 V17G possibly damaging Het
Farsa T C 8: 84,861,045 probably null Het
Fat2 G C 11: 55,281,280 T2869S possibly damaging Het
Fgg A T 3: 83,012,976 Q354L probably damaging Het
Folh1 T C 7: 86,723,309 D679G probably damaging Het
Gbp4 T A 5: 105,123,109 R83* probably null Het
Gm17482 T A 6: 115,227,350 probably benign Het
Hmgxb4 T A 8: 75,023,299 V481D possibly damaging Het
Ifi207 A C 1: 173,725,053 Y926D probably damaging Het
Ikzf5 T A 7: 131,391,648 N264Y probably damaging Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Krt33b A T 11: 100,024,868 C351S probably benign Het
Lrp1 T C 10: 127,592,075 D543G probably damaging Het
Lrrfip2 C T 9: 111,223,953 R339W probably damaging Het
Mapk3 T G 7: 126,764,282 M276R probably benign Het
Mgst1 T C 6: 138,150,829 V137A probably benign Het
Muc4 C T 16: 32,753,946 S1274F possibly damaging Het
Myo5c A C 9: 75,272,916 K713T possibly damaging Het
Myzap T C 9: 71,558,864 D170G possibly damaging Het
Naa50 T C 16: 44,159,468 V113A probably damaging Het
Neu3 T C 7: 99,813,722 T265A probably benign Het
Nin T C 12: 70,014,857 T2078A possibly damaging Het
Nomo1 G A 7: 46,033,836 probably benign Het
Nov T C 15: 54,748,025 probably null Het
Nprl3 A G 11: 32,239,828 L273P probably damaging Het
Oaf T A 9: 43,224,919 H120L possibly damaging Het
Olfr1053 T C 2: 86,315,124 H54R probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr982 T C 9: 40,074,528 S78P probably damaging Het
Pcdhga3 T A 18: 37,676,621 probably benign Het
Polq G A 16: 37,017,356 probably null Het
Prdm8 C T 5: 98,185,303 P243L possibly damaging Het
Prim2 T C 1: 33,662,292 D138G probably benign Het
Prl2c5 A G 13: 13,190,590 E107G probably benign Het
Prr14l T A 5: 32,827,525 H1542L probably damaging Het
Rab26 T C 17: 24,530,098 E203G probably damaging Het
Rtkn2 A T 10: 68,035,832 H350L possibly damaging Het
Scara3 T C 14: 65,938,261 D19G probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Sdcbp A G 4: 6,385,059 M93V probably benign Het
Sema6a C A 18: 47,249,164 R772L probably damaging Het
Slc5a7 T C 17: 54,276,978 K428R probably benign Het
Sptbn2 G A 19: 4,724,646 G109D probably damaging Het
Tmppe T C 9: 114,404,744 L37P probably benign Het
Tuba1a T C 15: 98,951,529 T56A probably benign Het
Vmn2r111 A G 17: 22,573,089 I62T probably benign Het
Vmn2r73 A G 7: 85,857,620 I828T probably damaging Het
Vmn2r79 T A 7: 87,037,768 W786R probably damaging Het
Zcchc11 T A 4: 108,555,620 I1506N probably damaging Het
Zp1 G A 19: 10,916,720 T405M probably null Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R7038_muc16_859 UTSW 9 18620468 missense probably damaging 0.99
Runneymeade UTSW 9 18579317 critical splice donor site probably null
slimey UTSW 9 18590698 missense probably damaging 1.00
viscous UTSW 9 18644732 missense unknown
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 splice site probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 splice site probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7921:Muc16 UTSW 9 18659318 missense unknown
R7922:Muc16 UTSW 9 18584825 missense probably benign 0.16
R7948:Muc16 UTSW 9 18642490 missense unknown
R7957:Muc16 UTSW 9 18643471 missense unknown
R7972:Muc16 UTSW 9 18645764 nonsense probably null
R7992:Muc16 UTSW 9 18656429 missense unknown
R7998:Muc16 UTSW 9 18639892 missense probably benign 0.04
R8014:Muc16 UTSW 9 18654875 missense unknown
R8033:Muc16 UTSW 9 18636606 missense probably benign 0.26
R8052:Muc16 UTSW 9 18659051 missense unknown
R8058:Muc16 UTSW 9 18660002 nonsense probably null
R8088:Muc16 UTSW 9 18519300 nonsense probably null
R8095:Muc16 UTSW 9 18584830 nonsense probably null
R8111:Muc16 UTSW 9 18592629 missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18658737 missense unknown
R8117:Muc16 UTSW 9 18508910 nonsense probably null
R8137:Muc16 UTSW 9 18645676 missense unknown
R8196:Muc16 UTSW 9 18645334 missense unknown
R8218:Muc16 UTSW 9 18637019 missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18642977 missense unknown
R8313:Muc16 UTSW 9 18525147 missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18658043 missense unknown
R8342:Muc16 UTSW 9 18658685 missense unknown
R8351:Muc16 UTSW 9 18659885 missense unknown
R8356:Muc16 UTSW 9 18658778 missense unknown
R8360:Muc16 UTSW 9 18525258 missense probably benign 0.01
R8418:Muc16 UTSW 9 18519630 missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18537511 missense probably damaging 0.99
R8437:Muc16 UTSW 9 18657924 missense unknown
R8463:Muc16 UTSW 9 18659139 missense unknown
R8466:Muc16 UTSW 9 18643148 missense unknown
R8512:Muc16 UTSW 9 18638192 missense probably benign 0.01
R8518:Muc16 UTSW 9 18519631 missense probably benign 0.12
R8556:Muc16 UTSW 9 18640937 missense probably benign 0.01
R8679:Muc16 UTSW 9 18646448 missense unknown
R8680:Muc16 UTSW 9 18644719 missense unknown
R8720:Muc16 UTSW 9 18641600 missense probably benign 0.01
R8729:Muc16 UTSW 9 18660050 missense unknown
R8736:Muc16 UTSW 9 18550843 nonsense probably null
R8739:Muc16 UTSW 9 18637298 missense probably benign 0.10
R8807:Muc16 UTSW 9 18656057 missense unknown
R8830:Muc16 UTSW 9 18646069 missense unknown
R8871:Muc16 UTSW 9 18656048 missense unknown
R8884:Muc16 UTSW 9 18644200 missense unknown
R8923:Muc16 UTSW 9 18638676 missense probably benign 0.01
R8948:Muc16 UTSW 9 18647233 missense unknown
R8949:Muc16 UTSW 9 18520925 critical splice donor site probably null
R8987:Muc16 UTSW 9 18551685 nonsense probably null
R8997:Muc16 UTSW 9 18607467 intron probably benign
R9013:Muc16 UTSW 9 18512773 missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18638719 small insertion probably benign
R9036:Muc16 UTSW 9 18644679 missense unknown
R9040:Muc16 UTSW 9 18644786 nonsense probably null
R9065:Muc16 UTSW 9 18643009 missense unknown
R9089:Muc16 UTSW 9 18644550 missense unknown
R9098:Muc16 UTSW 9 18643679 missense unknown
R9100:Muc16 UTSW 9 18645670 missense unknown
R9128:Muc16 UTSW 9 18647582 missense unknown
R9169:Muc16 UTSW 9 18656528 missense unknown
R9180:Muc16 UTSW 9 18642742 missense unknown
R9191:Muc16 UTSW 9 18644810 missense unknown
R9203:Muc16 UTSW 9 18551688 missense unknown
R9208:Muc16 UTSW 9 18508537 missense probably damaging 0.99
R9232:Muc16 UTSW 9 18656040 missense unknown
R9240:Muc16 UTSW 9 18538013 missense unknown
R9254:Muc16 UTSW 9 18646171 missense unknown
R9330:Muc16 UTSW 9 18641036 missense probably benign 0.04
R9347:Muc16 UTSW 9 18660215 missense unknown
R9358:Muc16 UTSW 9 18642224 missense probably benign 0.01
R9359:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9379:Muc16 UTSW 9 18646171 missense unknown
R9403:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9422:Muc16 UTSW 9 18641806 missense probably benign 0.01
R9433:Muc16 UTSW 9 18572641 missense probably benign 0.09
R9438:Muc16 UTSW 9 18647732 missense unknown
R9442:Muc16 UTSW 9 18655328 missense unknown
R9453:Muc16 UTSW 9 18660765 missense unknown
R9467:Muc16 UTSW 9 18597035 missense probably benign 0.03
Z1177:Muc16 UTSW 9 18537571 missense probably benign 0.26
Z1177:Muc16 UTSW 9 18657861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGTGAATCAGTCTTTCCCC -3'
(R):5'- CCCCAGATTCCCAGTCTTAAG -3'

Sequencing Primer
(F):5'- GTCTTTCCCCCAGCATGAGAGATAAG -3'
(R):5'- TCTTAAGACAAAGACCATCCCAAATG -3'
Posted On 2018-04-02