Incidental Mutation 'R6307:Tmppe'
ID509484
Institutional Source Beutler Lab
Gene Symbol Tmppe
Ensembl Gene ENSMUSG00000079260
Gene Nametransmembrane protein with metallophosphoesterase domain
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.596) question?
Stock #R6307 (G1)
Quality Score181.009
Status Not validated
Chromosome9
Chromosomal Location114401105-114407276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114404744 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 37 (L37P)
Ref Sequence ENSEMBL: ENSMUSP00000107451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063042] [ENSMUST00000111820] [ENSMUST00000217583]
Predicted Effect probably benign
Transcript: ENSMUST00000063042
SMART Domains Protein: ENSMUSP00000055803
Gene: ENSMUSG00000045594

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 41 358 2.5e-129 PFAM
Pfam:Glyco_hydro_42 56 216 9.4e-15 PFAM
Pfam:BetaGal_dom4_5 531 623 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111820
AA Change: L37P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107451
Gene: ENSMUSG00000079260
AA Change: L37P

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Metallophos 207 389 5.1e-13 PFAM
Pfam:Metallophos_2 207 421 7.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217583
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype Homozygotes for a targeted null mutation exhibit progressive spastic diplegia, emaciation, and accumulation of ganglioside GM1 and asialo GM1 in brain tissue. Mutants die at 7-10 months of age.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,007,387 L1232P probably damaging Het
Akap6 A T 12: 53,141,568 I1922F possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arpc5 T C 1: 152,771,455 V103A possibly damaging Het
Atp9a C A 2: 168,668,170 V430F probably benign Het
Bod1 A G 11: 31,666,932 S110P probably damaging Het
Cacna1c C A 6: 118,613,953 V1453F probably damaging Het
Capn8 T A 1: 182,607,699 M414K probably damaging Het
Cbl A T 9: 44,158,512 probably null Het
Ccdc42 A T 11: 68,588,280 Q98L probably damaging Het
Cd200 C A 16: 45,397,182 V49L probably benign Het
Celsr1 A G 15: 85,928,330 S2060P probably benign Het
Ces1g A T 8: 93,331,192 H160Q possibly damaging Het
Chrnb2 G T 3: 89,761,524 H161Q probably damaging Het
Ctns G A 11: 73,191,733 T57I probably benign Het
Cyp3a25 A T 5: 145,994,956 M114K possibly damaging Het
D630003M21Rik A G 2: 158,215,951 F536L probably benign Het
Dcc C T 18: 71,810,755 R275Q probably benign Het
Dmxl2 A T 9: 54,382,706 H2508Q possibly damaging Het
Elf5 C A 2: 103,439,412 Q113K probably damaging Het
Fam83a T G 15: 57,986,111 V17G possibly damaging Het
Farsa T C 8: 84,861,045 probably null Het
Fat2 G C 11: 55,281,280 T2869S possibly damaging Het
Fgg A T 3: 83,012,976 Q354L probably damaging Het
Folh1 T C 7: 86,723,309 D679G probably damaging Het
Gbp4 T A 5: 105,123,109 R83* probably null Het
Gm17482 T A 6: 115,227,350 probably benign Het
Hmgxb4 T A 8: 75,023,299 V481D possibly damaging Het
Ifi207 A C 1: 173,725,053 Y926D probably damaging Het
Ikzf5 T A 7: 131,391,648 N264Y probably damaging Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Krt33b A T 11: 100,024,868 C351S probably benign Het
Lrp1 T C 10: 127,592,075 D543G probably damaging Het
Lrrfip2 C T 9: 111,223,953 R339W probably damaging Het
Mapk3 T G 7: 126,764,282 M276R probably benign Het
Mgst1 T C 6: 138,150,829 V137A probably benign Het
Muc16 T C 9: 18,647,588 T2470A unknown Het
Muc4 C T 16: 32,753,946 S1274F possibly damaging Het
Myo5c A C 9: 75,272,916 K713T possibly damaging Het
Myzap T C 9: 71,558,864 D170G possibly damaging Het
Naa50 T C 16: 44,159,468 V113A probably damaging Het
Neu3 T C 7: 99,813,722 T265A probably benign Het
Nin T C 12: 70,014,857 T2078A possibly damaging Het
Nomo1 G A 7: 46,033,836 probably benign Het
Nov T C 15: 54,748,025 probably null Het
Nprl3 A G 11: 32,239,828 L273P probably damaging Het
Oaf T A 9: 43,224,919 H120L possibly damaging Het
Olfr1053 T C 2: 86,315,124 H54R probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr982 T C 9: 40,074,528 S78P probably damaging Het
Pcdhga3 T A 18: 37,676,621 probably null Het
Polq G A 16: 37,017,356 probably null Het
Prdm8 C T 5: 98,185,303 P243L possibly damaging Het
Prim2 T C 1: 33,662,292 D138G probably benign Het
Prl2c5 A G 13: 13,190,590 E107G probably benign Het
Prr14l T A 5: 32,827,525 H1542L probably damaging Het
Rab26 T C 17: 24,530,098 E203G probably damaging Het
Rtkn2 A T 10: 68,035,832 H350L possibly damaging Het
Scara3 T C 14: 65,938,261 D19G probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Sdcbp A G 4: 6,385,059 M93V probably benign Het
Sema6a C A 18: 47,249,164 R772L probably damaging Het
Slc5a7 T C 17: 54,276,978 K428R probably benign Het
Sptbn2 G A 19: 4,724,646 G109D probably damaging Het
Tuba1a T C 15: 98,951,529 T56A probably benign Het
Vmn2r111 A G 17: 22,573,089 I62T probably benign Het
Vmn2r73 A G 7: 85,857,620 I828T probably damaging Het
Vmn2r79 T A 7: 87,037,768 W786R probably damaging Het
Zcchc11 T A 4: 108,555,620 I1506N probably damaging Het
Zp1 G A 19: 10,916,720 T405M probably null Het
Other mutations in Tmppe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Tmppe APN 9 114405107 missense probably benign 0.03
IGL02274:Tmppe APN 9 114405431 missense probably benign
IGL02349:Tmppe APN 9 114405200 missense probably benign
R0201:Tmppe UTSW 9 114404639 frame shift probably null
R1668:Tmppe UTSW 9 114404900 missense possibly damaging 0.89
R2206:Tmppe UTSW 9 114405572 missense probably benign
R5026:Tmppe UTSW 9 114405819 missense possibly damaging 0.90
R5054:Tmppe UTSW 9 114405958 missense probably benign 0.41
R5118:Tmppe UTSW 9 114405481 missense probably benign 0.02
R5623:Tmppe UTSW 9 114405896 missense possibly damaging 0.59
R6502:Tmppe UTSW 9 114405652 missense probably damaging 1.00
R6597:Tmppe UTSW 9 114405244 missense probably benign 0.00
R6627:Tmppe UTSW 9 114405485 missense probably damaging 1.00
R6888:Tmppe UTSW 9 114404701 missense probably damaging 1.00
R6954:Tmppe UTSW 9 114405523 missense probably benign 0.06
R7032:Tmppe UTSW 9 114405790 missense probably damaging 1.00
R7141:Tmppe UTSW 9 114404968 missense probably benign 0.00
R7642:Tmppe UTSW 9 114404794 missense possibly damaging 0.95
Z1088:Tmppe UTSW 9 114405077 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCAGGAAGTCACTTGCCC -3'
(R):5'- AAACATGTAGGGTTCCTCGGC -3'

Sequencing Primer
(F):5'- AGAATGACGCTCTTCAGG -3'
(R):5'- GTTCCTCGGCCACCAAGAAG -3'
Posted On2018-04-02