Incidental Mutation 'R6307:Nprl3'
ID 509489
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 044412-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R6307 (G1)
Quality Score 141.008
Status Not validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32189828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 273 (L273P)
Ref Sequence ENSEMBL: ENSMUSP00000105016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000141859] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000149526]
AlphaFold Q8VIJ8
Predicted Effect probably damaging
Transcript: ENSMUST00000020530
AA Change: L298P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: L298P

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109389
AA Change: L273P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: L273P

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123411
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146890
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129573
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 79,843,221 (GRCm39) L1232P probably damaging Het
Akap6 A T 12: 53,188,351 (GRCm39) I1922F possibly damaging Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Arpc5 T C 1: 152,647,206 (GRCm39) V103A possibly damaging Het
Atp9a C A 2: 168,510,090 (GRCm39) V430F probably benign Het
Bod1 A G 11: 31,616,932 (GRCm39) S110P probably damaging Het
Cacna1c C A 6: 118,590,914 (GRCm39) V1453F probably damaging Het
Capn8 T A 1: 182,435,264 (GRCm39) M414K probably damaging Het
Cbl A T 9: 44,069,809 (GRCm39) probably null Het
Ccdc42 A T 11: 68,479,106 (GRCm39) Q98L probably damaging Het
Ccn3 T C 15: 54,611,421 (GRCm39) probably null Het
Cd200 C A 16: 45,217,545 (GRCm39) V49L probably benign Het
Celsr1 A G 15: 85,812,531 (GRCm39) S2060P probably benign Het
Ces1g A T 8: 94,057,820 (GRCm39) H160Q possibly damaging Het
Chrnb2 G T 3: 89,668,831 (GRCm39) H161Q probably damaging Het
Ctns G A 11: 73,082,559 (GRCm39) T57I probably benign Het
Cyp3a25 A T 5: 145,931,766 (GRCm39) M114K possibly damaging Het
D630003M21Rik A G 2: 158,057,871 (GRCm39) F536L probably benign Het
Dcc C T 18: 71,943,826 (GRCm39) R275Q probably benign Het
Dmxl2 A T 9: 54,289,990 (GRCm39) H2508Q possibly damaging Het
Elf5 C A 2: 103,269,757 (GRCm39) Q113K probably damaging Het
Fam83a T G 15: 57,849,507 (GRCm39) V17G possibly damaging Het
Farsa T C 8: 85,587,674 (GRCm39) probably null Het
Fat2 G C 11: 55,172,106 (GRCm39) T2869S possibly damaging Het
Fgg A T 3: 82,920,283 (GRCm39) Q354L probably damaging Het
Folh1 T C 7: 86,372,517 (GRCm39) D679G probably damaging Het
Gbp4 T A 5: 105,270,975 (GRCm39) R83* probably null Het
Gm17482 T A 6: 115,204,311 (GRCm39) probably benign Het
Hmgxb4 T A 8: 75,749,927 (GRCm39) V481D possibly damaging Het
Ifi207 A C 1: 173,552,619 (GRCm39) Y926D probably damaging Het
Ikzf5 T A 7: 130,993,377 (GRCm39) N264Y probably damaging Het
Kat6a T A 8: 23,430,384 (GRCm39) M1913K unknown Het
Krt33b A T 11: 99,915,694 (GRCm39) C351S probably benign Het
Lrp1 T C 10: 127,427,944 (GRCm39) D543G probably damaging Het
Lrrfip2 C T 9: 111,053,021 (GRCm39) R339W probably damaging Het
Mapk3 T G 7: 126,363,454 (GRCm39) M276R probably benign Het
Mgst1 T C 6: 138,127,827 (GRCm39) V137A probably benign Het
Muc16 T C 9: 18,558,884 (GRCm39) T2470A unknown Het
Muc4 C T 16: 32,575,237 (GRCm39) S1274F possibly damaging Het
Myo5c A C 9: 75,180,198 (GRCm39) K713T possibly damaging Het
Myzap T C 9: 71,466,146 (GRCm39) D170G possibly damaging Het
Naa50 T C 16: 43,979,831 (GRCm39) V113A probably damaging Het
Neu3 T C 7: 99,462,929 (GRCm39) T265A probably benign Het
Nin T C 12: 70,061,631 (GRCm39) T2078A possibly damaging Het
Nomo1 G A 7: 45,683,260 (GRCm39) probably benign Het
Oaf T A 9: 43,136,216 (GRCm39) H120L possibly damaging Het
Or10s1 T C 9: 39,985,824 (GRCm39) S78P probably damaging Het
Or13p4 C T 4: 118,547,145 (GRCm39) R168H probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or8k21 T C 2: 86,145,468 (GRCm39) H54R probably benign Het
Pcdhga3 T A 18: 37,809,674 (GRCm39) probably benign Het
Polq G A 16: 36,837,718 (GRCm39) probably null Het
Prdm8 C T 5: 98,333,162 (GRCm39) P243L possibly damaging Het
Prim2 T C 1: 33,701,373 (GRCm39) D138G probably benign Het
Prl2c5 A G 13: 13,365,175 (GRCm39) E107G probably benign Het
Prr14l T A 5: 32,984,869 (GRCm39) H1542L probably damaging Het
Rab26 T C 17: 24,749,072 (GRCm39) E203G probably damaging Het
Rtkn2 A T 10: 67,871,662 (GRCm39) H350L possibly damaging Het
Scara3 T C 14: 66,175,710 (GRCm39) D19G probably benign Het
Scn3a A G 2: 65,302,685 (GRCm39) S1254P probably damaging Het
Sdcbp A G 4: 6,385,059 (GRCm39) M93V probably benign Het
Sema6a C A 18: 47,382,231 (GRCm39) R772L probably damaging Het
Slc5a7 T C 17: 54,584,006 (GRCm39) K428R probably benign Het
Sptbn2 G A 19: 4,774,674 (GRCm39) G109D probably damaging Het
Tmppe T C 9: 114,233,812 (GRCm39) L37P probably benign Het
Tuba1a T C 15: 98,849,410 (GRCm39) T56A probably benign Het
Tut4 T A 4: 108,412,817 (GRCm39) I1506N probably damaging Het
Vmn2r111 A G 17: 22,792,070 (GRCm39) I62T probably benign Het
Vmn2r73 A G 7: 85,506,828 (GRCm39) I828T probably damaging Het
Vmn2r79 T A 7: 86,686,976 (GRCm39) W786R probably damaging Het
Zp1 G A 19: 10,894,084 (GRCm39) T405M probably null Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGTGACCAGATACCAGAACC -3'
(R):5'- TGCTTACTTGGTACAGGGCC -3'

Sequencing Primer
(F):5'- TACCCTCATCTGTGGCAGGAC -3'
(R):5'- TTGGTACAGGGCCCCGTG -3'
Posted On 2018-04-02