Incidental Mutation 'R6307:Scara3'
ID509497
Institutional Source Beutler Lab
Gene Symbol Scara3
Ensembl Gene ENSMUSG00000034463
Gene Namescavenger receptor class A, member 3
SynonymsC130058N24Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172604; MGI: 2444418

Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6307 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location65919394-65953935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65938261 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 19 (D19G)
Ref Sequence ENSEMBL: ENSMUSP00000046525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042046]
Predicted Effect probably benign
Transcript: ENSMUST00000042046
AA Change: D19G

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000046525
Gene: ENSMUSG00000034463
AA Change: D19G

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
coiled coil region 117 155 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Collagen 455 513 3.1e-12 PFAM
Pfam:Collagen 499 558 4.2e-11 PFAM
Pfam:Collagen 544 606 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a macrophage scavenger receptor-like protein. This protein has been shown to deplete reactive oxygen species, and thus play an important role in protecting cells from oxidative stress. The expression of this gene is induced by oxidative stress. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,007,387 L1232P probably damaging Het
Akap6 A T 12: 53,141,568 I1922F possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arpc5 T C 1: 152,771,455 V103A possibly damaging Het
Atp9a C A 2: 168,668,170 V430F probably benign Het
Bod1 A G 11: 31,666,932 S110P probably damaging Het
Cacna1c C A 6: 118,613,953 V1453F probably damaging Het
Capn8 T A 1: 182,607,699 M414K probably damaging Het
Cbl A T 9: 44,158,512 probably null Het
Ccdc42 A T 11: 68,588,280 Q98L probably damaging Het
Cd200 C A 16: 45,397,182 V49L probably benign Het
Celsr1 A G 15: 85,928,330 S2060P probably benign Het
Ces1g A T 8: 93,331,192 H160Q possibly damaging Het
Chrnb2 G T 3: 89,761,524 H161Q probably damaging Het
Ctns G A 11: 73,191,733 T57I probably benign Het
Cyp3a25 A T 5: 145,994,956 M114K possibly damaging Het
D630003M21Rik A G 2: 158,215,951 F536L probably benign Het
Dcc C T 18: 71,810,755 R275Q probably benign Het
Dmxl2 A T 9: 54,382,706 H2508Q possibly damaging Het
Elf5 C A 2: 103,439,412 Q113K probably damaging Het
Fam83a T G 15: 57,986,111 V17G possibly damaging Het
Farsa T C 8: 84,861,045 probably null Het
Fat2 G C 11: 55,281,280 T2869S possibly damaging Het
Fgg A T 3: 83,012,976 Q354L probably damaging Het
Folh1 T C 7: 86,723,309 D679G probably damaging Het
Gbp4 T A 5: 105,123,109 R83* probably null Het
Gm17482 T A 6: 115,227,350 probably benign Het
Hmgxb4 T A 8: 75,023,299 V481D possibly damaging Het
Ifi207 A C 1: 173,725,053 Y926D probably damaging Het
Ikzf5 T A 7: 131,391,648 N264Y probably damaging Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Krt33b A T 11: 100,024,868 C351S probably benign Het
Lrp1 T C 10: 127,592,075 D543G probably damaging Het
Lrrfip2 C T 9: 111,223,953 R339W probably damaging Het
Mapk3 T G 7: 126,764,282 M276R probably benign Het
Mgst1 T C 6: 138,150,829 V137A probably benign Het
Muc16 T C 9: 18,647,588 T2470A unknown Het
Muc4 C T 16: 32,753,946 S1274F possibly damaging Het
Myo5c A C 9: 75,272,916 K713T possibly damaging Het
Myzap T C 9: 71,558,864 D170G possibly damaging Het
Naa50 T C 16: 44,159,468 V113A probably damaging Het
Neu3 T C 7: 99,813,722 T265A probably benign Het
Nin T C 12: 70,014,857 T2078A possibly damaging Het
Nomo1 G A 7: 46,033,836 probably benign Het
Nov T C 15: 54,748,025 probably null Het
Nprl3 A G 11: 32,239,828 L273P probably damaging Het
Oaf T A 9: 43,224,919 H120L possibly damaging Het
Olfr1053 T C 2: 86,315,124 H54R probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr982 T C 9: 40,074,528 S78P probably damaging Het
Pcdhga3 T A 18: 37,676,621 probably benign Het
Polq G A 16: 37,017,356 probably null Het
Prdm8 C T 5: 98,185,303 P243L possibly damaging Het
Prim2 T C 1: 33,662,292 D138G probably benign Het
Prl2c5 A G 13: 13,190,590 E107G probably benign Het
Prr14l T A 5: 32,827,525 H1542L probably damaging Het
Rab26 T C 17: 24,530,098 E203G probably damaging Het
Rtkn2 A T 10: 68,035,832 H350L possibly damaging Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Sdcbp A G 4: 6,385,059 M93V probably benign Het
Sema6a C A 18: 47,249,164 R772L probably damaging Het
Slc5a7 T C 17: 54,276,978 K428R probably benign Het
Sptbn2 G A 19: 4,724,646 G109D probably damaging Het
Tmppe T C 9: 114,404,744 L37P probably benign Het
Tuba1a T C 15: 98,951,529 T56A probably benign Het
Vmn2r111 A G 17: 22,573,089 I62T probably benign Het
Vmn2r73 A G 7: 85,857,620 I828T probably damaging Het
Vmn2r79 T A 7: 87,037,768 W786R probably damaging Het
Zcchc11 T A 4: 108,555,620 I1506N probably damaging Het
Zp1 G A 19: 10,916,720 T405M probably null Het
Other mutations in Scara3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Scara3 APN 14 65933121 missense probably benign 0.01
IGL00646:Scara3 APN 14 65921156 nonsense probably null
IGL00718:Scara3 APN 14 65931427 missense possibly damaging 0.67
IGL01948:Scara3 APN 14 65930812 missense probably damaging 0.99
IGL01979:Scara3 APN 14 65930963 missense probably benign 0.01
IGL02399:Scara3 APN 14 65933110 nonsense probably null
IGL02939:Scara3 APN 14 65931656 missense probably benign 0.00
IGL02945:Scara3 APN 14 65931211 missense probably damaging 1.00
IGL03075:Scara3 APN 14 65931154 missense probably damaging 1.00
IGL03100:Scara3 APN 14 65931273 missense probably damaging 1.00
IGL03156:Scara3 APN 14 65931154 missense probably damaging 1.00
IGL03179:Scara3 APN 14 65931154 missense probably damaging 1.00
condor UTSW 14 65931202 missense probably damaging 1.00
PIT4362001:Scara3 UTSW 14 65936402 missense probably benign
R0062:Scara3 UTSW 14 65930968 missense probably damaging 1.00
R0062:Scara3 UTSW 14 65930968 missense probably damaging 1.00
R0124:Scara3 UTSW 14 65931221 missense probably benign 0.01
R0349:Scara3 UTSW 14 65931781 missense probably damaging 0.98
R1584:Scara3 UTSW 14 65921104 missense probably damaging 1.00
R4785:Scara3 UTSW 14 65953501 start codon destroyed probably null 0.06
R5336:Scara3 UTSW 14 65931038 missense probably damaging 1.00
R6420:Scara3 UTSW 14 65938252 missense possibly damaging 0.92
R6610:Scara3 UTSW 14 65931221 missense probably damaging 0.97
R7159:Scara3 UTSW 14 65920780 missense probably damaging 0.98
R7208:Scara3 UTSW 14 65931266 missense possibly damaging 0.62
R7246:Scara3 UTSW 14 65931644 missense probably damaging 0.97
R7315:Scara3 UTSW 14 65931440 missense probably damaging 1.00
R7324:Scara3 UTSW 14 65931416 missense probably benign 0.03
R7497:Scara3 UTSW 14 65931202 missense probably damaging 1.00
R7504:Scara3 UTSW 14 65931331 missense possibly damaging 0.82
R7554:Scara3 UTSW 14 65920850 missense possibly damaging 0.69
R8143:Scara3 UTSW 14 65931820 missense probably damaging 0.96
YA93:Scara3 UTSW 14 65930949 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGGACACATGACACTTATGAC -3'
(R):5'- ATTGGACCTAGGAACTATGCG -3'

Sequencing Primer
(F):5'- TGCCATTCACTCTCCAAGGAG -3'
(R):5'- CCTAGGAACTATGCGGACATG -3'
Posted On2018-04-02