Mutagenetix > Incidental Mutation

Incidental Mutation 'R6307:Vmn2r111'

509506

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R6307 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22573089 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 62 (I62T)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: I62T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: I62T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	C	10: 80,007,387	L1232P	probably damaging	Het
Akap6	A	T	12: 53,141,568	I1922F	possibly damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arpc5	T	C	1: 152,771,455	V103A	possibly damaging	Het
Atp9a	C	A	2: 168,668,170	V430F	probably benign	Het
Bod1	A	G	11: 31,666,932	S110P	probably damaging	Het
Cacna1c	C	A	6: 118,613,953	V1453F	probably damaging	Het
Capn8	T	A	1: 182,607,699	M414K	probably damaging	Het
Cbl	A	T	9: 44,158,512		probably null	Het
Ccdc42	A	T	11: 68,588,280	Q98L	probably damaging	Het
Cd200	C	A	16: 45,397,182	V49L	probably benign	Het
Celsr1	A	G	15: 85,928,330	S2060P	probably benign	Het
Ces1g	A	T	8: 93,331,192	H160Q	possibly damaging	Het
Chrnb2	G	T	3: 89,761,524	H161Q	probably damaging	Het
Ctns	G	A	11: 73,191,733	T57I	probably benign	Het
Cyp3a25	A	T	5: 145,994,956	M114K	possibly damaging	Het
D630003M21Rik	A	G	2: 158,215,951	F536L	probably benign	Het
Dcc	C	T	18: 71,810,755	R275Q	probably benign	Het
Dmxl2	A	T	9: 54,382,706	H2508Q	possibly damaging	Het
Elf5	C	A	2: 103,439,412	Q113K	probably damaging	Het
Fam83a	T	G	15: 57,986,111	V17G	possibly damaging	Het
Farsa	T	C	8: 84,861,045		probably null	Het
Fat2	G	C	11: 55,281,280	T2869S	possibly damaging	Het
Fgg	A	T	3: 83,012,976	Q354L	probably damaging	Het
Folh1	T	C	7: 86,723,309	D679G	probably damaging	Het
Gbp4	T	A	5: 105,123,109	R83*	probably null	Het
Gm17482	T	A	6: 115,227,350		probably benign	Het
Hmgxb4	T	A	8: 75,023,299	V481D	possibly damaging	Het
Ifi207	A	C	1: 173,725,053	Y926D	probably damaging	Het
Ikzf5	T	A	7: 131,391,648	N264Y	probably damaging	Het
Kat6a	T	A	8: 22,940,368	M1913K	unknown	Het
Krt33b	A	T	11: 100,024,868	C351S	probably benign	Het
Lrp1	T	C	10: 127,592,075	D543G	probably damaging	Het
Lrrfip2	C	T	9: 111,223,953	R339W	probably damaging	Het
Mapk3	T	G	7: 126,764,282	M276R	probably benign	Het
Mgst1	T	C	6: 138,150,829	V137A	probably benign	Het
Muc16	T	C	9: 18,647,588	T2470A	unknown	Het
Muc4	C	T	16: 32,753,946	S1274F	possibly damaging	Het
Myo5c	A	C	9: 75,272,916	K713T	possibly damaging	Het
Myzap	T	C	9: 71,558,864	D170G	possibly damaging	Het
Naa50	T	C	16: 44,159,468	V113A	probably damaging	Het
Neu3	T	C	7: 99,813,722	T265A	probably benign	Het
Nin	T	C	12: 70,014,857	T2078A	possibly damaging	Het
Nomo1	G	A	7: 46,033,836		probably benign	Het
Nov	T	C	15: 54,748,025		probably null	Het
Nprl3	A	G	11: 32,239,828	L273P	probably damaging	Het
Oaf	T	A	9: 43,224,919	H120L	possibly damaging	Het
Olfr1053	T	C	2: 86,315,124	H54R	probably benign	Het
Olfr1342	C	T	4: 118,689,948	R168H	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Olfr982	T	C	9: 40,074,528	S78P	probably damaging	Het
Pcdhga3	T	A	18: 37,676,621		probably benign	Het
Polq	G	A	16: 37,017,356		probably null	Het
Prdm8	C	T	5: 98,185,303	P243L	possibly damaging	Het
Prim2	T	C	1: 33,662,292	D138G	probably benign	Het
Prl2c5	A	G	13: 13,190,590	E107G	probably benign	Het
Prr14l	T	A	5: 32,827,525	H1542L	probably damaging	Het
Rab26	T	C	17: 24,530,098	E203G	probably damaging	Het
Rtkn2	A	T	10: 68,035,832	H350L	possibly damaging	Het
Scara3	T	C	14: 65,938,261	D19G	probably benign	Het
Scn3a	A	G	2: 65,472,341	S1254P	probably damaging	Het
Sdcbp	A	G	4: 6,385,059	M93V	probably benign	Het
Sema6a	C	A	18: 47,249,164	R772L	probably damaging	Het
Slc5a7	T	C	17: 54,276,978	K428R	probably benign	Het
Sptbn2	G	A	19: 4,724,646	G109D	probably damaging	Het
Tmppe	T	C	9: 114,404,744	L37P	probably benign	Het
Tuba1a	T	C	15: 98,951,529	T56A	probably benign	Het
Vmn2r73	A	G	7: 85,857,620	I828T	probably damaging	Het
Vmn2r79	T	A	7: 87,037,768	W786R	probably damaging	Het
Zcchc11	T	A	4: 108,555,620	I1506N	probably damaging	Het
Zp1	G	A	19: 10,916,720	T405M	probably null	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTGTGAAATGGAAACTGTCTAGG -3'
(R):5'- ATACTGCCCAGGCTCAGAAC -3'

Sequencing Primer
(F):5'- GCTAAGTTTCCATCCTTGTTAATGAG -3'
(R):5'- CCCAGGCTCAGAACAGGAAAAATATG -3'

Posted On

2018-04-02