Incidental Mutation 'R6307:Vmn2r111'
ID 509506
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission 044412-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R6307 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22766922-22792254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22792070 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 62 (I62T)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect probably benign
Transcript: ENSMUST00000092491
AA Change: I62T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: I62T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 79,843,221 (GRCm39) L1232P probably damaging Het
Akap6 A T 12: 53,188,351 (GRCm39) I1922F possibly damaging Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Arpc5 T C 1: 152,647,206 (GRCm39) V103A possibly damaging Het
Atp9a C A 2: 168,510,090 (GRCm39) V430F probably benign Het
Bod1 A G 11: 31,616,932 (GRCm39) S110P probably damaging Het
Cacna1c C A 6: 118,590,914 (GRCm39) V1453F probably damaging Het
Capn8 T A 1: 182,435,264 (GRCm39) M414K probably damaging Het
Cbl A T 9: 44,069,809 (GRCm39) probably null Het
Ccdc42 A T 11: 68,479,106 (GRCm39) Q98L probably damaging Het
Ccn3 T C 15: 54,611,421 (GRCm39) probably null Het
Cd200 C A 16: 45,217,545 (GRCm39) V49L probably benign Het
Celsr1 A G 15: 85,812,531 (GRCm39) S2060P probably benign Het
Ces1g A T 8: 94,057,820 (GRCm39) H160Q possibly damaging Het
Chrnb2 G T 3: 89,668,831 (GRCm39) H161Q probably damaging Het
Ctns G A 11: 73,082,559 (GRCm39) T57I probably benign Het
Cyp3a25 A T 5: 145,931,766 (GRCm39) M114K possibly damaging Het
D630003M21Rik A G 2: 158,057,871 (GRCm39) F536L probably benign Het
Dcc C T 18: 71,943,826 (GRCm39) R275Q probably benign Het
Dmxl2 A T 9: 54,289,990 (GRCm39) H2508Q possibly damaging Het
Elf5 C A 2: 103,269,757 (GRCm39) Q113K probably damaging Het
Fam83a T G 15: 57,849,507 (GRCm39) V17G possibly damaging Het
Farsa T C 8: 85,587,674 (GRCm39) probably null Het
Fat2 G C 11: 55,172,106 (GRCm39) T2869S possibly damaging Het
Fgg A T 3: 82,920,283 (GRCm39) Q354L probably damaging Het
Folh1 T C 7: 86,372,517 (GRCm39) D679G probably damaging Het
Gbp4 T A 5: 105,270,975 (GRCm39) R83* probably null Het
Gm17482 T A 6: 115,204,311 (GRCm39) probably benign Het
Hmgxb4 T A 8: 75,749,927 (GRCm39) V481D possibly damaging Het
Ifi207 A C 1: 173,552,619 (GRCm39) Y926D probably damaging Het
Ikzf5 T A 7: 130,993,377 (GRCm39) N264Y probably damaging Het
Kat6a T A 8: 23,430,384 (GRCm39) M1913K unknown Het
Krt33b A T 11: 99,915,694 (GRCm39) C351S probably benign Het
Lrp1 T C 10: 127,427,944 (GRCm39) D543G probably damaging Het
Lrrfip2 C T 9: 111,053,021 (GRCm39) R339W probably damaging Het
Mapk3 T G 7: 126,363,454 (GRCm39) M276R probably benign Het
Mgst1 T C 6: 138,127,827 (GRCm39) V137A probably benign Het
Muc16 T C 9: 18,558,884 (GRCm39) T2470A unknown Het
Muc4 C T 16: 32,575,237 (GRCm39) S1274F possibly damaging Het
Myo5c A C 9: 75,180,198 (GRCm39) K713T possibly damaging Het
Myzap T C 9: 71,466,146 (GRCm39) D170G possibly damaging Het
Naa50 T C 16: 43,979,831 (GRCm39) V113A probably damaging Het
Neu3 T C 7: 99,462,929 (GRCm39) T265A probably benign Het
Nin T C 12: 70,061,631 (GRCm39) T2078A possibly damaging Het
Nomo1 G A 7: 45,683,260 (GRCm39) probably benign Het
Nprl3 A G 11: 32,189,828 (GRCm39) L273P probably damaging Het
Oaf T A 9: 43,136,216 (GRCm39) H120L possibly damaging Het
Or10s1 T C 9: 39,985,824 (GRCm39) S78P probably damaging Het
Or13p4 C T 4: 118,547,145 (GRCm39) R168H probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or8k21 T C 2: 86,145,468 (GRCm39) H54R probably benign Het
Pcdhga3 T A 18: 37,809,674 (GRCm39) probably benign Het
Polq G A 16: 36,837,718 (GRCm39) probably null Het
Prdm8 C T 5: 98,333,162 (GRCm39) P243L possibly damaging Het
Prim2 T C 1: 33,701,373 (GRCm39) D138G probably benign Het
Prl2c5 A G 13: 13,365,175 (GRCm39) E107G probably benign Het
Prr14l T A 5: 32,984,869 (GRCm39) H1542L probably damaging Het
Rab26 T C 17: 24,749,072 (GRCm39) E203G probably damaging Het
Rtkn2 A T 10: 67,871,662 (GRCm39) H350L possibly damaging Het
Scara3 T C 14: 66,175,710 (GRCm39) D19G probably benign Het
Scn3a A G 2: 65,302,685 (GRCm39) S1254P probably damaging Het
Sdcbp A G 4: 6,385,059 (GRCm39) M93V probably benign Het
Sema6a C A 18: 47,382,231 (GRCm39) R772L probably damaging Het
Slc5a7 T C 17: 54,584,006 (GRCm39) K428R probably benign Het
Sptbn2 G A 19: 4,774,674 (GRCm39) G109D probably damaging Het
Tmppe T C 9: 114,233,812 (GRCm39) L37P probably benign Het
Tuba1a T C 15: 98,849,410 (GRCm39) T56A probably benign Het
Tut4 T A 4: 108,412,817 (GRCm39) I1506N probably damaging Het
Vmn2r73 A G 7: 85,506,828 (GRCm39) I828T probably damaging Het
Vmn2r79 T A 7: 86,686,976 (GRCm39) W786R probably damaging Het
Zp1 G A 19: 10,894,084 (GRCm39) T405M probably null Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22,767,734 (GRCm39) missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22,787,965 (GRCm39) missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22,787,997 (GRCm39) missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22,790,966 (GRCm39) nonsense probably null
IGL01465:Vmn2r111 APN 17 22,767,718 (GRCm39) missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22,767,553 (GRCm39) missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22,790,373 (GRCm39) missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22,788,054 (GRCm39) splice site probably benign
IGL01962:Vmn2r111 APN 17 22,767,265 (GRCm39) missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22,789,754 (GRCm39) missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22,787,837 (GRCm39) missense probably benign
IGL02519:Vmn2r111 APN 17 22,767,320 (GRCm39) missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22,790,031 (GRCm39) missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22,792,205 (GRCm39) missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22,778,023 (GRCm39) critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22,790,226 (GRCm39) missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22,789,839 (GRCm39) missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22,766,990 (GRCm39) missense probably benign
R0064:Vmn2r111 UTSW 17 22,791,053 (GRCm39) missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22,792,102 (GRCm39) missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22,790,097 (GRCm39) missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22,790,380 (GRCm39) missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22,767,041 (GRCm39) missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22,767,062 (GRCm39) missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22,767,395 (GRCm39) missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22,778,043 (GRCm39) missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22,792,085 (GRCm39) missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22,778,151 (GRCm39) splice site probably benign
R3700:Vmn2r111 UTSW 17 22,790,142 (GRCm39) nonsense probably null
R3782:Vmn2r111 UTSW 17 22,790,301 (GRCm39) missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22,778,096 (GRCm39) missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22,792,159 (GRCm39) missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22,767,637 (GRCm39) missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22,767,022 (GRCm39) missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22,790,124 (GRCm39) missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22,790,001 (GRCm39) missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22,767,083 (GRCm39) nonsense probably null
R5398:Vmn2r111 UTSW 17 22,792,252 (GRCm39) start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22,767,470 (GRCm39) missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22,767,238 (GRCm39) missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6149:Vmn2r111 UTSW 17 22,767,796 (GRCm39) missense probably benign 0.00
R6207:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6323:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22,790,889 (GRCm39) missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22,767,583 (GRCm39) missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22,790,226 (GRCm39) missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22,767,165 (GRCm39) missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22,767,695 (GRCm39) missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22,790,067 (GRCm39) missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22,767,380 (GRCm39) missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22,789,714 (GRCm39) missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22,792,083 (GRCm39) missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22,790,469 (GRCm39) missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22,792,073 (GRCm39) missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22,767,562 (GRCm39) missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22,790,274 (GRCm39) missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22,778,024 (GRCm39) missense probably damaging 1.00
R8540:Vmn2r111 UTSW 17 22,778,023 (GRCm39) critical splice donor site probably null
R8557:Vmn2r111 UTSW 17 22,790,910 (GRCm39) nonsense probably null
R8720:Vmn2r111 UTSW 17 22,792,194 (GRCm39) missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22,767,239 (GRCm39) missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22,767,011 (GRCm39) missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22,790,822 (GRCm39) missense probably benign
R9374:Vmn2r111 UTSW 17 22,787,859 (GRCm39) missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22,778,132 (GRCm39) missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22,767,676 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGTGAAATGGAAACTGTCTAGG -3'
(R):5'- ATACTGCCCAGGCTCAGAAC -3'

Sequencing Primer
(F):5'- GCTAAGTTTCCATCCTTGTTAATGAG -3'
(R):5'- CCCAGGCTCAGAACAGGAAAAATATG -3'
Posted On 2018-04-02