Incidental Mutation 'R6310:Intu'
ID 509522
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
MMRRC Submission 044414-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 40531286-40704774 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 40701291 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 936 (L936*)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably null
Transcript: ENSMUST00000091186
AA Change: L936*
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: L936*

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,482,220 G856A possibly damaging Het
Adgrb3 T A 1: 25,111,718 M1145L probably benign Het
Akap13 A T 7: 75,749,193 H2673L probably damaging Het
Bmpr1b A G 3: 141,864,536 S131P probably damaging Het
Cep72 A C 13: 74,053,025 S175A possibly damaging Het
Chd2 C T 7: 73,453,164 E1358K probably damaging Het
Cmip T C 8: 117,429,810 I308T possibly damaging Het
Cps1 A T 1: 67,142,981 N118I probably benign Het
Cux1 C T 5: 136,275,164 G1265D probably benign Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dhx58 T C 11: 100,699,367 S364G probably benign Het
Dis3l A C 9: 64,322,575 V274G probably benign Het
Fryl A T 5: 73,191,761 probably benign Het
Gbf1 A G 19: 46,280,005 H1272R probably damaging Het
Gjb3 A G 4: 127,326,640 V33A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm9964 T C 11: 79,296,650 probably benign Het
Grk5 T C 19: 61,080,911 I342T probably damaging Het
Hnf1b T A 11: 83,904,911 C527S probably damaging Het
Hoxd4 G T 2: 74,728,390 A186S possibly damaging Het
Ighv1-78 G A 12: 115,868,964 H54Y probably benign Het
Kcp G A 6: 29,493,258 R89W probably damaging Het
Kctd3 T C 1: 188,972,238 T779A probably benign Het
Muc16 G A 9: 18,641,950 P4349L probably benign Het
Nedd9 T C 13: 41,318,452 T178A probably benign Het
Nuak2 G T 1: 132,329,961 A204S probably damaging Het
Olfr566 T A 7: 102,857,205 I26F probably benign Het
Olfr807 T C 10: 129,754,659 R264G probably benign Het
Pcdhac2 C A 18: 37,145,771 Y601* probably null Het
Pla2g4a T A 1: 149,842,226 D624V possibly damaging Het
Plxnb1 T C 9: 109,109,728 V1386A probably damaging Het
Plxnd1 T A 6: 115,976,736 L623F possibly damaging Het
Pms2 T A 5: 143,923,583 S71R probably benign Het
Prkg1 T C 19: 30,569,251 D683G probably damaging Het
Rasgrp3 T A 17: 75,494,209 Y45N probably damaging Het
Rfc4 T C 16: 23,114,709 I233M probably benign Het
Sema3a G A 5: 13,557,019 G274S probably damaging Het
Sesn1 T C 10: 41,896,078 L201P probably damaging Het
Setx G A 2: 29,176,935 V2363I possibly damaging Het
Sh3glb1 A G 3: 144,697,467 S81P probably damaging Het
Sik3 A G 9: 46,178,486 S218G probably damaging Het
Slc12a2 C G 18: 57,915,506 F781L probably damaging Het
Slc12a6 A T 2: 112,335,839 I188F probably damaging Het
Slc34a2 A G 5: 53,064,797 probably null Het
Slc35f4 A G 14: 49,322,457 C44R probably damaging Het
Sytl1 G A 4: 133,260,998 P16S probably benign Het
Taok3 C T 5: 117,255,938 T592M possibly damaging Het
Tgfb1i1 T C 7: 128,252,837 F303L probably damaging Het
Txk T C 5: 72,736,417 S7G probably benign Het
Utp4 T C 8: 106,918,621 V550A probably benign Het
Vmn1r229 G A 17: 20,814,714 D74N probably benign Het
Zfp638 A G 6: 83,867,230 D25G possibly damaging Het
Zfp646 T C 7: 127,883,907 V1752A probably benign Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 splice site probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
R8860:Intu UTSW 3 40672732 missense probably benign 0.07
R8926:Intu UTSW 3 40653709 missense possibly damaging 0.69
R8946:Intu UTSW 3 40683359 missense possibly damaging 0.93
R9164:Intu UTSW 3 40690703 missense probably damaging 1.00
R9191:Intu UTSW 3 40692511 missense probably damaging 0.99
R9547:Intu UTSW 3 40654106 missense probably benign
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGGAGTTTCTACACTCTAAGACAG -3'
(R):5'- ACTGATGGACCAACCCAATAGG -3'

Sequencing Primer
(F):5'- AAAACTGGGCTGTATTCTGTTTTC -3'
(R):5'- GATGGACCAACCCAATAGGATTGC -3'
Posted On 2018-04-02