Incidental Mutation 'R6310:Txk'
ID509529
Institutional Source Beutler Lab
Gene Symbol Txk
Ensembl Gene ENSMUSG00000054892
Gene NameTXK tyrosine kinase
SynonymsA130089B16Rik, PTK4, Btkl, Rlk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6310 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location72695978-72752777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72736417 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 7 (S7G)
Ref Sequence ENSEMBL: ENSMUSP00000129397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113604] [ENSMUST00000169534] [ENSMUST00000197313] [ENSMUST00000198464]
Predicted Effect unknown
Transcript: ENSMUST00000113604
AA Change: S7G
SMART Domains Protein: ENSMUSP00000109234
Gene: ENSMUSG00000054892
AA Change: S7G

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169534
AA Change: S7G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000129397
Gene: ENSMUSG00000054892
AA Change: S7G

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect unknown
Transcript: ENSMUST00000197313
AA Change: S7G
SMART Domains Protein: ENSMUSP00000143476
Gene: ENSMUSG00000054892
AA Change: S7G

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 138 1.2e-9 SMART
SH2 126 215 3.1e-35 SMART
TyrKc 249 498 1.2e-136 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197843
Predicted Effect probably benign
Transcript: ENSMUST00000198464
SMART Domains Protein: ENSMUSP00000143002
Gene: ENSMUSG00000054892

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
SH3 31 87 6.3e-19 SMART
SH2 94 183 5.4e-36 SMART
TyrKc 217 466 1.2e-136 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198970
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased susceptibility to parasitic (Toxoplasma gondii) infection and decreased cytokine secretion in stimulated splenocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,482,220 G856A possibly damaging Het
Adgrb3 T A 1: 25,111,718 M1145L probably benign Het
Akap13 A T 7: 75,749,193 H2673L probably damaging Het
Bmpr1b A G 3: 141,864,536 S131P probably damaging Het
Cep72 A C 13: 74,053,025 S175A possibly damaging Het
Chd2 C T 7: 73,453,164 E1358K probably damaging Het
Cmip T C 8: 117,429,810 I308T possibly damaging Het
Cps1 A T 1: 67,142,981 N118I probably benign Het
Cux1 C T 5: 136,275,164 G1265D probably benign Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dhx58 T C 11: 100,699,367 S364G probably benign Het
Dis3l A C 9: 64,322,575 V274G probably benign Het
Fryl A T 5: 73,191,761 probably benign Het
Gbf1 A G 19: 46,280,005 H1272R probably damaging Het
Gjb3 A G 4: 127,326,640 V33A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm9964 T C 11: 79,296,650 probably benign Het
Grk5 T C 19: 61,080,911 I342T probably damaging Het
Hnf1b T A 11: 83,904,911 C527S probably damaging Het
Hoxd4 G T 2: 74,728,390 A186S possibly damaging Het
Ighv1-78 G A 12: 115,868,964 H54Y probably benign Het
Intu T A 3: 40,701,291 L936* probably null Het
Kcp G A 6: 29,493,258 R89W probably damaging Het
Kctd3 T C 1: 188,972,238 T779A probably benign Het
Muc16 G A 9: 18,641,950 P4349L probably benign Het
Nedd9 T C 13: 41,318,452 T178A probably benign Het
Nuak2 G T 1: 132,329,961 A204S probably damaging Het
Olfr566 T A 7: 102,857,205 I26F probably benign Het
Olfr807 T C 10: 129,754,659 R264G probably benign Het
Pcdhac2 C A 18: 37,145,771 Y601* probably null Het
Pla2g4a T A 1: 149,842,226 D624V possibly damaging Het
Plxnb1 T C 9: 109,109,728 V1386A probably damaging Het
Plxnd1 T A 6: 115,976,736 L623F possibly damaging Het
Pms2 T A 5: 143,923,583 S71R probably benign Het
Prkg1 T C 19: 30,569,251 D683G probably damaging Het
Rasgrp3 T A 17: 75,494,209 Y45N probably damaging Het
Rfc4 T C 16: 23,114,709 I233M probably benign Het
Sema3a G A 5: 13,557,019 G274S probably damaging Het
Sesn1 T C 10: 41,896,078 L201P probably damaging Het
Setx G A 2: 29,176,935 V2363I possibly damaging Het
Sh3glb1 A G 3: 144,697,467 S81P probably damaging Het
Sik3 A G 9: 46,178,486 S218G probably damaging Het
Slc12a2 C G 18: 57,915,506 F781L probably damaging Het
Slc12a6 A T 2: 112,335,839 I188F probably damaging Het
Slc34a2 A G 5: 53,064,797 probably null Het
Slc35f4 A G 14: 49,322,457 C44R probably damaging Het
Sytl1 G A 4: 133,260,998 P16S probably benign Het
Taok3 C T 5: 117,255,938 T592M possibly damaging Het
Tgfb1i1 T C 7: 128,252,837 F303L probably damaging Het
Utp4 T C 8: 106,918,621 V550A probably benign Het
Vmn1r229 G A 17: 20,814,714 D74N probably benign Het
Zfp638 A G 6: 83,867,230 D25G possibly damaging Het
Zfp646 T C 7: 127,883,907 V1752A probably benign Het
Other mutations in Txk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Txk APN 5 72707546 missense possibly damaging 0.94
IGL02602:Txk APN 5 72707720 missense possibly damaging 0.89
IGL03353:Txk APN 5 72736402 missense probably benign
BB007:Txk UTSW 5 72735193 missense probably damaging 1.00
BB017:Txk UTSW 5 72735193 missense probably damaging 1.00
R0402:Txk UTSW 5 72731762 critical splice donor site probably null
R1509:Txk UTSW 5 72699110 missense probably damaging 1.00
R1511:Txk UTSW 5 72707671 missense probably damaging 1.00
R1785:Txk UTSW 5 72696579 missense probably damaging 1.00
R1786:Txk UTSW 5 72696579 missense probably damaging 1.00
R2131:Txk UTSW 5 72696579 missense probably damaging 1.00
R2913:Txk UTSW 5 72724451 missense probably damaging 1.00
R2914:Txk UTSW 5 72724451 missense probably damaging 1.00
R3722:Txk UTSW 5 72707735 nonsense probably null
R4080:Txk UTSW 5 72700663 missense probably damaging 1.00
R5341:Txk UTSW 5 72696621 missense probably benign 0.08
R5580:Txk UTSW 5 72707589 missense probably damaging 1.00
R6155:Txk UTSW 5 72700726 missense probably damaging 1.00
R6382:Txk UTSW 5 72736480 intron probably benign
R6938:Txk UTSW 5 72699149 missense probably damaging 0.99
R7225:Txk UTSW 5 72700714 missense probably damaging 1.00
R7327:Txk UTSW 5 72715883 missense probably damaging 0.98
R7337:Txk UTSW 5 72731766 nonsense probably null
R7436:Txk UTSW 5 72696579 missense probably damaging 1.00
R7510:Txk UTSW 5 72736383 missense unknown
R7709:Txk UTSW 5 72707575 missense probably damaging 1.00
R7725:Txk UTSW 5 72707557 missense probably damaging 0.96
R7930:Txk UTSW 5 72735193 missense probably damaging 1.00
R8124:Txk UTSW 5 72703263 splice site probably null
Z1176:Txk UTSW 5 72735211 missense unknown
Predicted Primers PCR Primer
(F):5'- GACCAAGTGGACAGAGCTTC -3'
(R):5'- GCCAGAGCGATGAACTTCAG -3'

Sequencing Primer
(F):5'- GTGGACAGAGCTTCCTAGACAC -3'
(R):5'- TGGTCAGGGTGCCAGAACTTC -3'
Posted On2018-04-02