Incidental Mutation 'R6310:Olfr566'
ID509539
Institutional Source Beutler Lab
Gene Symbol Olfr566
Ensembl Gene ENSMUSG00000060888
Gene Nameolfactory receptor 566
SynonymsMOR14-7P, GA_x6K02T2PBJ9-5560696-5559746
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6310 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102855337-102858765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102857205 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 26 (I26F)
Ref Sequence ENSEMBL: ENSMUSP00000148998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071393] [ENSMUST00000209952] [ENSMUST00000213481]
Predicted Effect probably benign
Transcript: ENSMUST00000071393
AA Change: I23F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071344
Gene: ENSMUSG00000060888
AA Change: I23F

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 1e-110 PFAM
Pfam:7TM_GPCR_Srsx 42 313 3.5e-6 PFAM
Pfam:7tm_1 47 298 9.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209952
AA Change: I26F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210522
Predicted Effect probably benign
Transcript: ENSMUST00000213481
AA Change: I26F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,482,220 G856A possibly damaging Het
Adgrb3 T A 1: 25,111,718 M1145L probably benign Het
Akap13 A T 7: 75,749,193 H2673L probably damaging Het
Bmpr1b A G 3: 141,864,536 S131P probably damaging Het
Cep72 A C 13: 74,053,025 S175A possibly damaging Het
Chd2 C T 7: 73,453,164 E1358K probably damaging Het
Cmip T C 8: 117,429,810 I308T possibly damaging Het
Cps1 A T 1: 67,142,981 N118I probably benign Het
Cux1 C T 5: 136,275,164 G1265D probably benign Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dhx58 T C 11: 100,699,367 S364G probably benign Het
Dis3l A C 9: 64,322,575 V274G probably benign Het
Fryl A T 5: 73,191,761 probably benign Het
Gbf1 A G 19: 46,280,005 H1272R probably damaging Het
Gjb3 A G 4: 127,326,640 V33A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm9964 T C 11: 79,296,650 probably benign Het
Grk5 T C 19: 61,080,911 I342T probably damaging Het
Hnf1b T A 11: 83,904,911 C527S probably damaging Het
Hoxd4 G T 2: 74,728,390 A186S possibly damaging Het
Ighv1-78 G A 12: 115,868,964 H54Y probably benign Het
Intu T A 3: 40,701,291 L936* probably null Het
Kcp G A 6: 29,493,258 R89W probably damaging Het
Kctd3 T C 1: 188,972,238 T779A probably benign Het
Muc16 G A 9: 18,641,950 P4349L probably benign Het
Nedd9 T C 13: 41,318,452 T178A probably benign Het
Nuak2 G T 1: 132,329,961 A204S probably damaging Het
Olfr807 T C 10: 129,754,659 R264G probably benign Het
Pcdhac2 C A 18: 37,145,771 Y601* probably null Het
Pla2g4a T A 1: 149,842,226 D624V possibly damaging Het
Plxnb1 T C 9: 109,109,728 V1386A probably damaging Het
Plxnd1 T A 6: 115,976,736 L623F possibly damaging Het
Pms2 T A 5: 143,923,583 S71R probably benign Het
Prkg1 T C 19: 30,569,251 D683G probably damaging Het
Rasgrp3 T A 17: 75,494,209 Y45N probably damaging Het
Rfc4 T C 16: 23,114,709 I233M probably benign Het
Sema3a G A 5: 13,557,019 G274S probably damaging Het
Sesn1 T C 10: 41,896,078 L201P probably damaging Het
Setx G A 2: 29,176,935 V2363I possibly damaging Het
Sh3glb1 A G 3: 144,697,467 S81P probably damaging Het
Sik3 A G 9: 46,178,486 S218G probably damaging Het
Slc12a2 C G 18: 57,915,506 F781L probably damaging Het
Slc12a6 A T 2: 112,335,839 I188F probably damaging Het
Slc34a2 A G 5: 53,064,797 probably null Het
Slc35f4 A G 14: 49,322,457 C44R probably damaging Het
Sytl1 G A 4: 133,260,998 P16S probably benign Het
Taok3 C T 5: 117,255,938 T592M possibly damaging Het
Tgfb1i1 T C 7: 128,252,837 F303L probably damaging Het
Txk T C 5: 72,736,417 S7G probably benign Het
Utp4 T C 8: 106,918,621 V550A probably benign Het
Vmn1r229 G A 17: 20,814,714 D74N probably benign Het
Zfp638 A G 6: 83,867,230 D25G possibly damaging Het
Zfp646 T C 7: 127,883,907 V1752A probably benign Het
Other mutations in Olfr566
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Olfr566 APN 7 102856824 missense probably benign
IGL03336:Olfr566 APN 7 102856616 missense probably benign 0.38
PIT4382001:Olfr566 UTSW 7 102856602 missense probably damaging 1.00
R1337:Olfr566 UTSW 7 102856871 missense probably benign 0.03
R1791:Olfr566 UTSW 7 102856362 nonsense probably null
R3953:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R3954:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R3955:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R3957:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R4734:Olfr566 UTSW 7 102856979 missense probably damaging 0.99
R5182:Olfr566 UTSW 7 102856969 missense probably benign 0.07
R5394:Olfr566 UTSW 7 102856479 missense probably damaging 1.00
R5559:Olfr566 UTSW 7 102857207 missense possibly damaging 0.94
R6023:Olfr566 UTSW 7 102856962 missense possibly damaging 0.95
R7312:Olfr566 UTSW 7 102856499 missense probably damaging 1.00
R7493:Olfr566 UTSW 7 102857071 nonsense probably null
R8409:Olfr566 UTSW 7 102857270 missense probably benign 0.01
R8476:Olfr566 UTSW 7 102856945 missense probably benign 0.22
R8747:Olfr566 UTSW 7 102856932 missense probably benign 0.05
R8946:Olfr566 UTSW 7 102856518 nonsense probably null
Z1177:Olfr566 UTSW 7 102856374 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGTCAAACCCAGGTCAGTGG -3'
(R):5'- GTGACTCTCCCACATTAAAACATTC -3'

Sequencing Primer
(F):5'- ACCCAGGTCAGTGGCAGAG -3'
(R):5'- ATTCACATAATCTGGTGAAAC -3'
Posted On2018-04-02