Incidental Mutation 'R6310:Gm11595'
ID509552
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Namepredicted gene 11595
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6310 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location99771714-99772913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99772555 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100C
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,482,220 G856A possibly damaging Het
Adgrb3 T A 1: 25,111,718 M1145L probably benign Het
Akap13 A T 7: 75,749,193 H2673L probably damaging Het
Bmpr1b A G 3: 141,864,536 S131P probably damaging Het
Cep72 A C 13: 74,053,025 S175A possibly damaging Het
Chd2 C T 7: 73,453,164 E1358K probably damaging Het
Cmip T C 8: 117,429,810 I308T possibly damaging Het
Cps1 A T 1: 67,142,981 N118I probably benign Het
Cux1 C T 5: 136,275,164 G1265D probably benign Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dhx58 T C 11: 100,699,367 S364G probably benign Het
Dis3l A C 9: 64,322,575 V274G probably benign Het
Fryl A T 5: 73,191,761 probably benign Het
Gbf1 A G 19: 46,280,005 H1272R probably damaging Het
Gjb3 A G 4: 127,326,640 V33A probably damaging Het
Gm9964 T C 11: 79,296,650 probably benign Het
Grk5 T C 19: 61,080,911 I342T probably damaging Het
Hnf1b T A 11: 83,904,911 C527S probably damaging Het
Hoxd4 G T 2: 74,728,390 A186S possibly damaging Het
Ighv1-78 G A 12: 115,868,964 H54Y probably benign Het
Intu T A 3: 40,701,291 L936* probably null Het
Kcp G A 6: 29,493,258 R89W probably damaging Het
Kctd3 T C 1: 188,972,238 T779A probably benign Het
Muc16 G A 9: 18,641,950 P4349L probably benign Het
Nedd9 T C 13: 41,318,452 T178A probably benign Het
Nuak2 G T 1: 132,329,961 A204S probably damaging Het
Olfr566 T A 7: 102,857,205 I26F probably benign Het
Olfr807 T C 10: 129,754,659 R264G probably benign Het
Pcdhac2 C A 18: 37,145,771 Y601* probably null Het
Pla2g4a T A 1: 149,842,226 D624V possibly damaging Het
Plxnb1 T C 9: 109,109,728 V1386A probably damaging Het
Plxnd1 T A 6: 115,976,736 L623F possibly damaging Het
Pms2 T A 5: 143,923,583 S71R probably benign Het
Prkg1 T C 19: 30,569,251 D683G probably damaging Het
Rasgrp3 T A 17: 75,494,209 Y45N probably damaging Het
Rfc4 T C 16: 23,114,709 I233M probably benign Het
Sema3a G A 5: 13,557,019 G274S probably damaging Het
Sesn1 T C 10: 41,896,078 L201P probably damaging Het
Setx G A 2: 29,176,935 V2363I possibly damaging Het
Sh3glb1 A G 3: 144,697,467 S81P probably damaging Het
Sik3 A G 9: 46,178,486 S218G probably damaging Het
Slc12a2 C G 18: 57,915,506 F781L probably damaging Het
Slc12a6 A T 2: 112,335,839 I188F probably damaging Het
Slc34a2 A G 5: 53,064,797 probably null Het
Slc35f4 A G 14: 49,322,457 C44R probably damaging Het
Sytl1 G A 4: 133,260,998 P16S probably benign Het
Taok3 C T 5: 117,255,938 T592M possibly damaging Het
Tgfb1i1 T C 7: 128,252,837 F303L probably damaging Het
Txk T C 5: 72,736,417 S7G probably benign Het
Utp4 T C 8: 106,918,621 V550A probably benign Het
Vmn1r229 G A 17: 20,814,714 D74N probably benign Het
Zfp638 A G 6: 83,867,230 D25G possibly damaging Het
Zfp646 T C 7: 127,883,907 V1752A probably benign Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99772042 missense unknown
IGL00987:Gm11595 APN 11 99772539 missense unknown
IGL01662:Gm11595 APN 11 99772672 missense unknown
IGL01994:Gm11595 APN 11 99772201 missense unknown
R0548:Gm11595 UTSW 11 99772141 missense unknown
R1923:Gm11595 UTSW 11 99772539 missense unknown
R2127:Gm11595 UTSW 11 99772501 missense unknown
R2128:Gm11595 UTSW 11 99772501 missense unknown
R3807:Gm11595 UTSW 11 99772554 missense unknown
R4007:Gm11595 UTSW 11 99772035 missense unknown
R5281:Gm11595 UTSW 11 99772555 missense unknown
R5283:Gm11595 UTSW 11 99772555 missense unknown
R5303:Gm11595 UTSW 11 99772555 missense unknown
R5305:Gm11595 UTSW 11 99772555 missense unknown
R5306:Gm11595 UTSW 11 99772555 missense unknown
R5307:Gm11595 UTSW 11 99772555 missense unknown
R5308:Gm11595 UTSW 11 99772555 missense unknown
R5561:Gm11595 UTSW 11 99772555 missense unknown
R5637:Gm11595 UTSW 11 99772555 missense unknown
R5639:Gm11595 UTSW 11 99772555 missense unknown
R5718:Gm11595 UTSW 11 99772555 missense unknown
R5719:Gm11595 UTSW 11 99772555 missense unknown
R5720:Gm11595 UTSW 11 99772555 missense unknown
R5721:Gm11595 UTSW 11 99772555 missense unknown
R5769:Gm11595 UTSW 11 99772555 missense unknown
R5770:Gm11595 UTSW 11 99772555 missense unknown
R5771:Gm11595 UTSW 11 99772555 missense unknown
R5791:Gm11595 UTSW 11 99772555 missense unknown
R5841:Gm11595 UTSW 11 99772317 missense unknown
R6054:Gm11595 UTSW 11 99772648 missense unknown
R6277:Gm11595 UTSW 11 99772684 missense unknown
R6281:Gm11595 UTSW 11 99772555 missense unknown
R6282:Gm11595 UTSW 11 99772555 missense unknown
R6321:Gm11595 UTSW 11 99772555 missense unknown
R6322:Gm11595 UTSW 11 99772555 missense unknown
R6327:Gm11595 UTSW 11 99772555 missense unknown
R6337:Gm11595 UTSW 11 99772555 missense unknown
R6368:Gm11595 UTSW 11 99772555 missense unknown
R6369:Gm11595 UTSW 11 99772555 missense unknown
R6431:Gm11595 UTSW 11 99772774 missense unknown
R6483:Gm11595 UTSW 11 99772555 missense unknown
R6485:Gm11595 UTSW 11 99772555 missense unknown
R6493:Gm11595 UTSW 11 99772555 missense unknown
R6758:Gm11595 UTSW 11 99772540 missense unknown
R6758:Gm11595 UTSW 11 99772541 nonsense probably null
R7037:Gm11595 UTSW 11 99772648 missense unknown
R8053:Gm11595 UTSW 11 99772128 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACCATGGTCAGTTCCTGTTGTG -3'

Sequencing Primer
(F):5'- CGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On2018-04-02