Incidental Mutation 'R6310:Grk5'
ID509567
Institutional Source Beutler Lab
Gene Symbol Grk5
Ensembl Gene ENSMUSG00000003228
Gene NameG protein-coupled receptor kinase 5
SynonymsGprk5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6310 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location60889749-61092553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61080911 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 342 (I342T)
Ref Sequence ENSEMBL: ENSMUSP00000003313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003313] [ENSMUST00000122927]
Predicted Effect probably damaging
Transcript: ENSMUST00000003313
AA Change: I342T

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003313
Gene: ENSMUSG00000003228
AA Change: I342T

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
RGS 52 171 1.21e-35 SMART
S_TKc 186 448 9.44e-84 SMART
S_TK_X 449 528 1.08e-9 SMART
low complexity region 561 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122927
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. It has also been shown to play a role in regulating the motility of polymorphonuclear leukocytes (PMNs). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a decrease in thermal pain sensation. Mice homozygous for a knock-out allele exhibit decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,482,220 G856A possibly damaging Het
Adgrb3 T A 1: 25,111,718 M1145L probably benign Het
Akap13 A T 7: 75,749,193 H2673L probably damaging Het
Bmpr1b A G 3: 141,864,536 S131P probably damaging Het
Cep72 A C 13: 74,053,025 S175A possibly damaging Het
Chd2 C T 7: 73,453,164 E1358K probably damaging Het
Cmip T C 8: 117,429,810 I308T possibly damaging Het
Cps1 A T 1: 67,142,981 N118I probably benign Het
Cux1 C T 5: 136,275,164 G1265D probably benign Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dhx58 T C 11: 100,699,367 S364G probably benign Het
Dis3l A C 9: 64,322,575 V274G probably benign Het
Fryl A T 5: 73,191,761 probably benign Het
Gbf1 A G 19: 46,280,005 H1272R probably damaging Het
Gjb3 A G 4: 127,326,640 V33A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm9964 T C 11: 79,296,650 probably benign Het
Hnf1b T A 11: 83,904,911 C527S probably damaging Het
Hoxd4 G T 2: 74,728,390 A186S possibly damaging Het
Ighv1-78 G A 12: 115,868,964 H54Y probably benign Het
Intu T A 3: 40,701,291 L936* probably null Het
Kcp G A 6: 29,493,258 R89W probably damaging Het
Kctd3 T C 1: 188,972,238 T779A probably benign Het
Muc16 G A 9: 18,641,950 P4349L probably benign Het
Nedd9 T C 13: 41,318,452 T178A probably benign Het
Nuak2 G T 1: 132,329,961 A204S probably damaging Het
Olfr566 T A 7: 102,857,205 I26F probably benign Het
Olfr807 T C 10: 129,754,659 R264G probably benign Het
Pcdhac2 C A 18: 37,145,771 Y601* probably null Het
Pla2g4a T A 1: 149,842,226 D624V possibly damaging Het
Plxnb1 T C 9: 109,109,728 V1386A probably damaging Het
Plxnd1 T A 6: 115,976,736 L623F possibly damaging Het
Pms2 T A 5: 143,923,583 S71R probably benign Het
Prkg1 T C 19: 30,569,251 D683G probably damaging Het
Rasgrp3 T A 17: 75,494,209 Y45N probably damaging Het
Rfc4 T C 16: 23,114,709 I233M probably benign Het
Sema3a G A 5: 13,557,019 G274S probably damaging Het
Sesn1 T C 10: 41,896,078 L201P probably damaging Het
Setx G A 2: 29,176,935 V2363I possibly damaging Het
Sh3glb1 A G 3: 144,697,467 S81P probably damaging Het
Sik3 A G 9: 46,178,486 S218G probably damaging Het
Slc12a2 C G 18: 57,915,506 F781L probably damaging Het
Slc12a6 A T 2: 112,335,839 I188F probably damaging Het
Slc34a2 A G 5: 53,064,797 probably null Het
Slc35f4 A G 14: 49,322,457 C44R probably damaging Het
Sytl1 G A 4: 133,260,998 P16S probably benign Het
Taok3 C T 5: 117,255,938 T592M possibly damaging Het
Tgfb1i1 T C 7: 128,252,837 F303L probably damaging Het
Txk T C 5: 72,736,417 S7G probably benign Het
Utp4 T C 8: 106,918,621 V550A probably benign Het
Vmn1r229 G A 17: 20,814,714 D74N probably benign Het
Zfp638 A G 6: 83,867,230 D25G possibly damaging Het
Zfp646 T C 7: 127,883,907 V1752A probably benign Het
Other mutations in Grk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Grk5 APN 19 61069371 missense probably damaging 0.99
IGL03183:Grk5 APN 19 61069336 missense probably damaging 0.99
R0257:Grk5 UTSW 19 61076630 intron probably benign
R1565:Grk5 UTSW 19 61089972 missense probably damaging 0.99
R1603:Grk5 UTSW 19 61069362 missense probably benign 0.06
R1672:Grk5 UTSW 19 61086215 splice site probably null
R1687:Grk5 UTSW 19 61076783 missense probably damaging 1.00
R1793:Grk5 UTSW 19 61076762 missense probably damaging 1.00
R1822:Grk5 UTSW 19 61089972 missense probably damaging 0.99
R1824:Grk5 UTSW 19 61089972 missense probably damaging 0.99
R1876:Grk5 UTSW 19 61083225 missense probably damaging 1.00
R4320:Grk5 UTSW 19 61091945 nonsense probably null
R4828:Grk5 UTSW 19 60987775 nonsense probably null
R5085:Grk5 UTSW 19 61076684 missense probably damaging 1.00
R6237:Grk5 UTSW 19 61089942 missense probably damaging 1.00
R6736:Grk5 UTSW 19 60890626 missense probably damaging 0.99
R7061:Grk5 UTSW 19 61046092 missense probably benign 0.00
R7248:Grk5 UTSW 19 60890607 missense probably benign 0.05
R7583:Grk5 UTSW 19 61083204 missense possibly damaging 0.85
R7852:Grk5 UTSW 19 61080945 critical splice donor site probably null
R7935:Grk5 UTSW 19 61080945 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCTGAGAAAGTAGGCTGATG -3'
(R):5'- GTCACCAAACTTCCAGGATGC -3'

Sequencing Primer
(F):5'- GCTGATGTCACATCTTCATTGGACAG -3'
(R):5'- AGTGTACCACTCTACCTGACTGAGG -3'
Posted On2018-04-02