Incidental Mutation 'R6305:Dll4'
ID509574
Institutional Source Beutler Lab
Gene Symbol Dll4
Ensembl Gene ENSMUSG00000027314
Gene Namedelta like canonical Notch ligand 4
SynonymsDelta4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6305 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119325784-119335962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119330657 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 299 (S299T)
Ref Sequence ENSEMBL: ENSMUSP00000099575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102517]
Predicted Effect probably benign
Transcript: ENSMUST00000102517
AA Change: S299T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099575
Gene: ENSMUSG00000027314
AA Change: S299T

DomainStartEndE-ValueType
Pfam:MNNL 27 92 7.3e-21 PFAM
low complexity region 139 150 N/A INTRINSIC
DSL 156 218 1.98e-23 SMART
EGF 222 252 5.62e0 SMART
EGF 253 283 5.79e-2 SMART
EGF_CA 285 323 1.38e-8 SMART
EGF_CA 329 361 5.36e-6 SMART
EGF 366 401 4.35e-6 SMART
EGF 406 439 1.44e-6 SMART
EGF_CA 441 477 2.33e-6 SMART
EGF 484 519 9.33e-6 SMART
transmembrane domain 530 552 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156538
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, absent vascular remodeling, small hearts, and embryonic growth retardation. Heterozygous null mice display background dependent partial or complete embryonic lethality, impaired vascular remodeling, and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,980 S977P probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adcy6 T A 15: 98,598,645 I550L probably benign Het
Agbl3 G A 6: 34,782,210 D19N unknown Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgap39 T A 15: 76,737,702 D233V probably benign Het
Bcl9 G A 3: 97,205,938 P1067L possibly damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Casd1 C T 6: 4,641,892 T723I probably damaging Het
Cd209g T A 8: 4,136,809 I118N probably benign Het
Cdh24 A T 14: 54,632,356 D701E possibly damaging Het
Chd9 C T 8: 91,030,546 P1858S possibly damaging Het
Csnk1g3 T A 18: 53,932,312 Y322* probably null Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
D130043K22Rik T C 13: 24,885,685 F909S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg4 T A 18: 20,449,790 Y162N probably damaging Het
Enpp1 T C 10: 24,641,882 Y882C probably damaging Het
Fam129a T C 1: 151,695,718 L248P probably damaging Het
Fbxw7 T A 3: 84,976,323 N520K probably damaging Het
Galc C T 12: 98,259,290 A14T possibly damaging Het
Gm11492 C T 11: 87,567,319 T173M probably benign Het
Grm7 G A 6: 111,358,665 R679Q probably damaging Het
Hnrnpdl T C 5: 100,038,658 probably benign Het
Il12a A T 3: 68,694,178 K77N possibly damaging Het
Il17rd C T 14: 27,095,942 S196L possibly damaging Het
Kcnv2 T C 19: 27,323,837 F363L probably benign Het
Lair1 A G 7: 4,010,728 probably null Het
Lrit3 G A 3: 129,800,460 T156I probably damaging Het
Me2 T A 18: 73,791,844 R267S probably benign Het
Mga T C 2: 119,947,698 V1908A probably benign Het
Mylk3 T A 8: 85,350,419 I463F probably damaging Het
Neb G A 2: 52,251,763 R75* probably null Het
Olfr1080 A G 2: 86,553,495 S210P possibly damaging Het
Olfr339 T A 2: 36,421,622 S75T probably damaging Het
Olfr469 T G 7: 107,822,657 T271P probably benign Het
Olfr516 C T 7: 108,845,554 G152D possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TG TGGTGTTGG 9: 38,026,542 probably null Het
Pfas A G 11: 69,001,197 S162P possibly damaging Het
Pip5k1c T A 10: 81,315,934 V654E probably benign Het
Plxdc1 C A 11: 97,938,590 C318F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rexo5 A T 7: 119,828,125 K419N probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc24a4 C A 12: 102,222,101 T151K possibly damaging Het
Slc6a15 A T 10: 103,389,170 I40F probably benign Het
Slc6a21 T C 7: 45,280,604 V172A possibly damaging Het
Thrap3 A G 4: 126,180,807 probably benign Het
Tm9sf3 A G 19: 41,245,442 probably null Het
Trp53 A T 11: 69,588,707 H211L probably damaging Het
Ttc21b A T 2: 66,188,270 N1264K probably damaging Het
Vmn1r120 A T 7: 21,053,606 V60E possibly damaging Het
Ylpm1 A G 12: 85,030,545 E890G probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp934 T C 13: 62,518,556 Y102C probably damaging Het
Other mutations in Dll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Dll4 APN 2 119331109 missense probably damaging 1.00
IGL01149:Dll4 APN 2 119332745 missense probably damaging 1.00
IGL02511:Dll4 APN 2 119326466 missense probably damaging 0.99
PIT4519001:Dll4 UTSW 2 119332416 missense probably benign 0.01
R0316:Dll4 UTSW 2 119331153 missense probably damaging 1.00
R0725:Dll4 UTSW 2 119332689 missense probably damaging 1.00
R0840:Dll4 UTSW 2 119326485 missense probably benign 0.01
R1014:Dll4 UTSW 2 119331157 missense probably damaging 1.00
R1650:Dll4 UTSW 2 119331130 missense probably damaging 1.00
R3813:Dll4 UTSW 2 119331029 missense possibly damaging 0.65
R3974:Dll4 UTSW 2 119334092 missense probably damaging 0.98
R5320:Dll4 UTSW 2 119326487 missense probably damaging 0.97
R6166:Dll4 UTSW 2 119334626 critical splice acceptor site probably null
R6455:Dll4 UTSW 2 119333795 splice site probably null
R6617:Dll4 UTSW 2 119327931 missense probably benign
R6843:Dll4 UTSW 2 119325994 start gained probably benign
R7204:Dll4 UTSW 2 119328573 missense probably damaging 0.98
R7251:Dll4 UTSW 2 119332292 missense probably damaging 1.00
Z1176:Dll4 UTSW 2 119326052 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TAGTTTCAGGCGAGTGAATGCTC -3'
(R):5'- ACCACACTGACTGGATGCTAC -3'

Sequencing Primer
(F):5'- ATGCTCAGGATTTCACAGGC -3'
(R):5'- ACTGGATGCTACCTGGTTAGACC -3'
Posted On2018-04-02