Incidental Mutation 'R6305:Il12a'
ID 509576
Institutional Source Beutler Lab
Gene Symbol Il12a
Ensembl Gene ENSMUSG00000027776
Gene Name interleukin 12a
Synonyms IL-12p35, p35
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6305 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 68690644-68698547 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68694178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 77 (K77N)
Ref Sequence ENSEMBL: ENSMUSP00000029345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029345] [ENSMUST00000107816]
AlphaFold P43431
Predicted Effect possibly damaging
Transcript: ENSMUST00000029345
AA Change: K77N

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776
AA Change: K77N

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
Pfam:IL12 27 236 2.5e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107816
AA Change: K56N

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776
AA Change: K56N

DomainStartEndE-ValueType
Pfam:IL12 1 215 6.8e-128 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195517
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,980 S977P probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adcy6 T A 15: 98,598,645 I550L probably benign Het
Agbl3 G A 6: 34,782,210 D19N unknown Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgap39 T A 15: 76,737,702 D233V probably benign Het
Bcl9 G A 3: 97,205,938 P1067L possibly damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Casd1 C T 6: 4,641,892 T723I probably damaging Het
Cd209g T A 8: 4,136,809 I118N probably benign Het
Cdh24 A T 14: 54,632,356 D701E possibly damaging Het
Chd9 C T 8: 91,030,546 P1858S possibly damaging Het
Csnk1g3 T A 18: 53,932,312 Y322* probably null Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
D130043K22Rik T C 13: 24,885,685 F909S probably damaging Het
Dll4 T A 2: 119,330,657 S299T probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg4 T A 18: 20,449,790 Y162N probably damaging Het
Enpp1 T C 10: 24,641,882 Y882C probably damaging Het
Fam129a T C 1: 151,695,718 L248P probably damaging Het
Fbxw7 T A 3: 84,976,323 N520K probably damaging Het
Galc C T 12: 98,259,290 A14T possibly damaging Het
Gm11492 C T 11: 87,567,319 T173M probably benign Het
Grm7 G A 6: 111,358,665 R679Q probably damaging Het
Hnrnpdl T C 5: 100,038,658 probably benign Het
Il17rd C T 14: 27,095,942 S196L possibly damaging Het
Kcnv2 T C 19: 27,323,837 F363L probably benign Het
Lair1 A G 7: 4,010,728 probably null Het
Lrit3 G A 3: 129,800,460 T156I probably damaging Het
Me2 T A 18: 73,791,844 R267S probably benign Het
Mga T C 2: 119,947,698 V1908A probably benign Het
Mylk3 T A 8: 85,350,419 I463F probably damaging Het
Neb G A 2: 52,251,763 R75* probably null Het
Olfr1080 A G 2: 86,553,495 S210P possibly damaging Het
Olfr339 T A 2: 36,421,622 S75T probably damaging Het
Olfr469 T G 7: 107,822,657 T271P probably benign Het
Olfr516 C T 7: 108,845,554 G152D possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TG TGGTGTTGG 9: 38,026,542 probably null Het
Pfas A G 11: 69,001,197 S162P possibly damaging Het
Pip5k1c T A 10: 81,315,934 V654E probably benign Het
Plxdc1 C A 11: 97,938,590 C318F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rexo5 A T 7: 119,828,125 K419N probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc24a4 C A 12: 102,222,101 T151K possibly damaging Het
Slc6a15 A T 10: 103,389,170 I40F probably benign Het
Slc6a21 T C 7: 45,280,604 V172A possibly damaging Het
Thrap3 A G 4: 126,180,807 probably benign Het
Tm9sf3 A G 19: 41,245,442 probably null Het
Trp53 A T 11: 69,588,707 H211L probably damaging Het
Ttc21b A T 2: 66,188,270 N1264K probably damaging Het
Vmn1r120 A T 7: 21,053,606 V60E possibly damaging Het
Ylpm1 A G 12: 85,030,545 E890G probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp934 T C 13: 62,518,556 Y102C probably damaging Het
Other mutations in Il12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Il12a APN 3 68691555 missense possibly damaging 0.96
IGL01820:Il12a APN 3 68692162 splice site probably benign
IGL01989:Il12a APN 3 68691576 splice site probably benign
bakers_dozen UTSW 3 68697987 frame shift probably null
R0388:Il12a UTSW 3 68695187 splice site probably null
R0646:Il12a UTSW 3 68697890 splice site probably benign
R1083:Il12a UTSW 3 68695333 missense probably damaging 1.00
R1588:Il12a UTSW 3 68695563 missense probably benign 0.04
R2240:Il12a UTSW 3 68694184 nonsense probably null
R2909:Il12a UTSW 3 68697987 frame shift probably null
R2925:Il12a UTSW 3 68697987 frame shift probably null
R3696:Il12a UTSW 3 68697987 frame shift probably null
R3697:Il12a UTSW 3 68697987 frame shift probably null
R3698:Il12a UTSW 3 68697987 frame shift probably null
R4332:Il12a UTSW 3 68695261 intron probably benign
R5809:Il12a UTSW 3 68695262 intron probably benign
R6279:Il12a UTSW 3 68697979 missense probably damaging 0.96
R6847:Il12a UTSW 3 68695566 missense probably damaging 1.00
R7751:Il12a UTSW 3 68697902 missense probably damaging 1.00
R8188:Il12a UTSW 3 68691539 missense unknown
R8339:Il12a UTSW 3 68692105 nonsense probably null
R9145:Il12a UTSW 3 68691542 missense unknown
RF003:Il12a UTSW 3 68695229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAATACCCTGCTGGCGGAC -3'
(R):5'- TAGCTACAAGTAAGTATCTGGAGAC -3'

Sequencing Primer
(F):5'- TGGGTTTCTTAGCTTATGAAGAGCC -3'
(R):5'- TGGAGACAGCTGAGGTTGGC -3'
Posted On 2018-04-02