Incidental Mutation 'R6305:Lrit3'
ID 509579
Institutional Source Beutler Lab
Gene Symbol Lrit3
Ensembl Gene ENSMUSG00000093865
Gene Name leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
Synonyms LOC242235
MMRRC Submission 044411-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6305 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 129581530-129597679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 129594109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 156 (T156I)
Ref Sequence ENSEMBL: ENSMUSP00000140184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171313] [ENSMUST00000179187] [ENSMUST00000185462]
AlphaFold W8DXL4
Predicted Effect probably benign
Transcript: ENSMUST00000171313
SMART Domains Protein: ENSMUSP00000132360
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 4.6e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179187
AA Change: T156I

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136912
Gene: ENSMUSG00000093865
AA Change: T156I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 2.7e-1 SMART
LRR 80 103 6.96e0 SMART
LRR 104 127 3.27e1 SMART
LRR_TYP 128 151 4.47e-3 SMART
LRR_TYP 152 175 7.37e-4 SMART
LRRCT 201 252 4.65e-2 SMART
Blast:IG 260 297 9e-13 BLAST
low complexity region 298 311 N/A INTRINSIC
FN3 364 443 1.85e0 SMART
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185462
AA Change: T156I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140184
Gene: ENSMUSG00000093865
AA Change: T156I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 1.3e-3 SMART
LRR 80 103 2.9e-2 SMART
LRR 104 127 1.4e-1 SMART
LRR_TYP 128 151 1.9e-5 SMART
LRR_TYP 152 175 3.2e-6 SMART
LRRCT 201 252 2.3e-4 SMART
IGc2 266 335 4.7e-11 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 362 376 N/A INTRINSIC
low complexity region 408 432 N/A INTRINSIC
FN3 485 564 9e-3 SMART
transmembrane domain 583 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196317
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele show a selective absence of the ERG b-wave with a normal a-wave component under scotopic conditions, as well as variable ERG responses with larger a-wave amplitudes, shorter b-wave amplitudes, and longer implicit times of both waves under photopic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,773,741 (GRCm39) S977P probably damaging Het
Abraxas2 G A 7: 132,476,694 (GRCm39) A145T probably damaging Het
Adcy6 T A 15: 98,496,526 (GRCm39) I550L probably benign Het
Agbl3 G A 6: 34,759,145 (GRCm39) D19N unknown Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Arhgap39 T A 15: 76,621,902 (GRCm39) D233V probably benign Het
Bcl9 G A 3: 97,113,254 (GRCm39) P1067L possibly damaging Het
Casd1 C T 6: 4,641,892 (GRCm39) T723I probably damaging Het
Cd209g T A 8: 4,186,809 (GRCm39) I118N probably benign Het
Cdh24 A T 14: 54,869,813 (GRCm39) D701E possibly damaging Het
Chd9 C T 8: 91,757,174 (GRCm39) P1858S possibly damaging Het
Csnk1g3 T A 18: 54,065,384 (GRCm39) Y322* probably null Het
Cyp2f2 G A 7: 26,828,649 (GRCm39) R173H probably damaging Het
D130043K22Rik T C 13: 25,069,668 (GRCm39) F909S probably damaging Het
Dll4 T A 2: 119,161,138 (GRCm39) S299T probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dsg4 T A 18: 20,582,847 (GRCm39) Y162N probably damaging Het
Enpp1 T C 10: 24,517,780 (GRCm39) Y882C probably damaging Het
Fbxw7 T A 3: 84,883,630 (GRCm39) N520K probably damaging Het
Galc C T 12: 98,225,549 (GRCm39) A14T possibly damaging Het
Grm7 G A 6: 111,335,626 (GRCm39) R679Q probably damaging Het
Hnrnpdl T C 5: 100,186,517 (GRCm39) probably benign Het
Il12a A T 3: 68,601,511 (GRCm39) K77N possibly damaging Het
Il17rd C T 14: 26,817,899 (GRCm39) S196L possibly damaging Het
Kcnv2 T C 19: 27,301,237 (GRCm39) F363L probably benign Het
Lair1 A G 7: 4,013,727 (GRCm39) probably null Het
Me2 T A 18: 73,924,915 (GRCm39) R267S probably benign Het
Mga T C 2: 119,778,179 (GRCm39) V1908A probably benign Het
Mylk3 T A 8: 86,077,048 (GRCm39) I463F probably damaging Het
Neb G A 2: 52,141,775 (GRCm39) R75* probably null Het
Niban1 T C 1: 151,571,469 (GRCm39) L248P probably damaging Het
Or10a3b C T 7: 108,444,761 (GRCm39) G152D possibly damaging Het
Or1j11 T A 2: 36,311,634 (GRCm39) S75T probably damaging Het
Or5p50 T G 7: 107,421,864 (GRCm39) T271P probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or8b36 TG TGGTGTTGG 9: 37,937,838 (GRCm39) probably null Het
Or8k33 A G 2: 86,383,839 (GRCm39) S210P possibly damaging Het
Pfas A G 11: 68,892,023 (GRCm39) S162P possibly damaging Het
Pip5k1c T A 10: 81,151,768 (GRCm39) V654E probably benign Het
Plxdc1 C A 11: 97,829,416 (GRCm39) C318F probably damaging Het
Qrfprl A T 6: 65,431,975 (GRCm39) M293L probably benign Het
Rbm8a2 T C 1: 175,806,312 (GRCm39) D55G probably benign Het
Rexo5 A T 7: 119,427,348 (GRCm39) K419N probably damaging Het
Septin4 C T 11: 87,458,145 (GRCm39) T173M probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,294,306 (GRCm39) probably benign Het
Slc24a4 C A 12: 102,188,360 (GRCm39) T151K possibly damaging Het
Slc6a15 A T 10: 103,225,031 (GRCm39) I40F probably benign Het
Slc6a21 T C 7: 44,930,028 (GRCm39) V172A possibly damaging Het
Thrap3 A G 4: 126,074,600 (GRCm39) probably benign Het
Tm9sf3 A G 19: 41,233,881 (GRCm39) probably null Het
Trp53 A T 11: 69,479,533 (GRCm39) H211L probably damaging Het
Ttc21b A T 2: 66,018,614 (GRCm39) N1264K probably damaging Het
Vmn1r120 A T 7: 20,787,531 (GRCm39) V60E possibly damaging Het
Ylpm1 A G 12: 85,077,319 (GRCm39) E890G probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp934 T C 13: 62,666,370 (GRCm39) Y102C probably damaging Het
Other mutations in Lrit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Lrit3 UTSW 3 129,582,468 (GRCm39) small insertion probably benign
FR4340:Lrit3 UTSW 3 129,582,457 (GRCm39) small insertion probably benign
FR4548:Lrit3 UTSW 3 129,582,465 (GRCm39) small insertion probably benign
FR4548:Lrit3 UTSW 3 129,582,462 (GRCm39) small insertion probably benign
FR4589:Lrit3 UTSW 3 129,597,562 (GRCm39) frame shift probably null
FR4737:Lrit3 UTSW 3 129,582,455 (GRCm39) small insertion probably benign
FR4737:Lrit3 UTSW 3 129,582,459 (GRCm39) small insertion probably benign
FR4737:Lrit3 UTSW 3 129,597,562 (GRCm39) frame shift probably null
FR4976:Lrit3 UTSW 3 129,597,559 (GRCm39) unclassified probably benign
R0555:Lrit3 UTSW 3 129,584,945 (GRCm39) missense probably damaging 1.00
R0629:Lrit3 UTSW 3 129,581,951 (GRCm39) missense probably damaging 1.00
R0631:Lrit3 UTSW 3 129,582,204 (GRCm39) missense probably damaging 1.00
R1690:Lrit3 UTSW 3 129,594,394 (GRCm39) missense probably damaging 0.99
R1902:Lrit3 UTSW 3 129,584,895 (GRCm39) missense probably benign 0.17
R1955:Lrit3 UTSW 3 129,594,130 (GRCm39) missense probably benign 0.11
R3155:Lrit3 UTSW 3 129,585,044 (GRCm39) missense probably benign 0.00
R4005:Lrit3 UTSW 3 129,585,021 (GRCm39) missense probably benign 0.14
R4445:Lrit3 UTSW 3 129,582,180 (GRCm39) nonsense probably null
R4675:Lrit3 UTSW 3 129,582,121 (GRCm39) missense probably damaging 1.00
R5104:Lrit3 UTSW 3 129,582,040 (GRCm39) missense possibly damaging 0.86
R5147:Lrit3 UTSW 3 129,597,574 (GRCm39) missense possibly damaging 0.78
R5271:Lrit3 UTSW 3 129,581,950 (GRCm39) missense probably damaging 1.00
R5505:Lrit3 UTSW 3 129,585,087 (GRCm39) missense possibly damaging 0.83
R5587:Lrit3 UTSW 3 129,582,547 (GRCm39) missense probably benign 0.25
R6056:Lrit3 UTSW 3 129,583,004 (GRCm39) missense probably damaging 1.00
R6239:Lrit3 UTSW 3 129,593,995 (GRCm39) missense probably damaging 0.98
R6280:Lrit3 UTSW 3 129,582,412 (GRCm39) missense probably damaging 0.99
R6441:Lrit3 UTSW 3 129,594,009 (GRCm39) missense probably benign
R6947:Lrit3 UTSW 3 129,582,883 (GRCm39) missense probably benign 0.01
R6949:Lrit3 UTSW 3 129,582,934 (GRCm39) missense probably damaging 1.00
R7850:Lrit3 UTSW 3 129,594,452 (GRCm39) missense probably damaging 1.00
R8157:Lrit3 UTSW 3 129,594,284 (GRCm39) missense probably benign 0.00
R8405:Lrit3 UTSW 3 129,582,301 (GRCm39) missense probably benign 0.26
R8896:Lrit3 UTSW 3 129,585,132 (GRCm39) missense probably damaging 1.00
R8937:Lrit3 UTSW 3 129,594,193 (GRCm39) missense probably damaging 1.00
R9794:Lrit3 UTSW 3 129,594,073 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGATCCCAGGTTAGATCCCC -3'
(R):5'- AGCTTCTATAACCTGAGGCAGC -3'

Sequencing Primer
(F):5'- AGGTTAGATCCCCATTGTTACACAC -3'
(R):5'- TTCTATAACCTGAGGCAGCTGCAC -3'
Posted On 2018-04-02