Incidental Mutation 'R6305:Slc6a21'
ID 509589
Institutional Source Beutler Lab
Gene Symbol Slc6a21
Ensembl Gene ENSMUSG00000070568
Gene Name solute carrier family 6 member 21
Synonyms 1700039E15Rik
MMRRC Submission 044411-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R6305 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44926937-44938422 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44930028 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 172 (V172A)
Ref Sequence ENSEMBL: ENSMUSP00000147890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085364] [ENSMUST00000210861]
AlphaFold A0A1B0GSD2
Predicted Effect probably benign
Transcript: ENSMUST00000085364
SMART Domains Protein: ENSMUSP00000082476
Gene: ENSMUSG00000070568

DomainStartEndE-ValueType
Pfam:SNF 1 306 8.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209886
Predicted Effect probably benign
Transcript: ENSMUST00000210207
Predicted Effect possibly damaging
Transcript: ENSMUST00000210861
AA Change: V172A

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,773,741 (GRCm39) S977P probably damaging Het
Abraxas2 G A 7: 132,476,694 (GRCm39) A145T probably damaging Het
Adcy6 T A 15: 98,496,526 (GRCm39) I550L probably benign Het
Agbl3 G A 6: 34,759,145 (GRCm39) D19N unknown Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Arhgap39 T A 15: 76,621,902 (GRCm39) D233V probably benign Het
Bcl9 G A 3: 97,113,254 (GRCm39) P1067L possibly damaging Het
Casd1 C T 6: 4,641,892 (GRCm39) T723I probably damaging Het
Cd209g T A 8: 4,186,809 (GRCm39) I118N probably benign Het
Cdh24 A T 14: 54,869,813 (GRCm39) D701E possibly damaging Het
Chd9 C T 8: 91,757,174 (GRCm39) P1858S possibly damaging Het
Csnk1g3 T A 18: 54,065,384 (GRCm39) Y322* probably null Het
Cyp2f2 G A 7: 26,828,649 (GRCm39) R173H probably damaging Het
D130043K22Rik T C 13: 25,069,668 (GRCm39) F909S probably damaging Het
Dll4 T A 2: 119,161,138 (GRCm39) S299T probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dsg4 T A 18: 20,582,847 (GRCm39) Y162N probably damaging Het
Enpp1 T C 10: 24,517,780 (GRCm39) Y882C probably damaging Het
Fbxw7 T A 3: 84,883,630 (GRCm39) N520K probably damaging Het
Galc C T 12: 98,225,549 (GRCm39) A14T possibly damaging Het
Grm7 G A 6: 111,335,626 (GRCm39) R679Q probably damaging Het
Hnrnpdl T C 5: 100,186,517 (GRCm39) probably benign Het
Il12a A T 3: 68,601,511 (GRCm39) K77N possibly damaging Het
Il17rd C T 14: 26,817,899 (GRCm39) S196L possibly damaging Het
Kcnv2 T C 19: 27,301,237 (GRCm39) F363L probably benign Het
Lair1 A G 7: 4,013,727 (GRCm39) probably null Het
Lrit3 G A 3: 129,594,109 (GRCm39) T156I probably damaging Het
Me2 T A 18: 73,924,915 (GRCm39) R267S probably benign Het
Mga T C 2: 119,778,179 (GRCm39) V1908A probably benign Het
Mylk3 T A 8: 86,077,048 (GRCm39) I463F probably damaging Het
Neb G A 2: 52,141,775 (GRCm39) R75* probably null Het
Niban1 T C 1: 151,571,469 (GRCm39) L248P probably damaging Het
Or10a3b C T 7: 108,444,761 (GRCm39) G152D possibly damaging Het
Or1j11 T A 2: 36,311,634 (GRCm39) S75T probably damaging Het
Or5p50 T G 7: 107,421,864 (GRCm39) T271P probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or8b36 TG TGGTGTTGG 9: 37,937,838 (GRCm39) probably null Het
Or8k33 A G 2: 86,383,839 (GRCm39) S210P possibly damaging Het
Pfas A G 11: 68,892,023 (GRCm39) S162P possibly damaging Het
Pip5k1c T A 10: 81,151,768 (GRCm39) V654E probably benign Het
Plxdc1 C A 11: 97,829,416 (GRCm39) C318F probably damaging Het
Qrfprl A T 6: 65,431,975 (GRCm39) M293L probably benign Het
Rbm8a2 T C 1: 175,806,312 (GRCm39) D55G probably benign Het
Rexo5 A T 7: 119,427,348 (GRCm39) K419N probably damaging Het
Septin4 C T 11: 87,458,145 (GRCm39) T173M probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,294,306 (GRCm39) probably benign Het
Slc24a4 C A 12: 102,188,360 (GRCm39) T151K possibly damaging Het
Slc6a15 A T 10: 103,225,031 (GRCm39) I40F probably benign Het
Thrap3 A G 4: 126,074,600 (GRCm39) probably benign Het
Tm9sf3 A G 19: 41,233,881 (GRCm39) probably null Het
Trp53 A T 11: 69,479,533 (GRCm39) H211L probably damaging Het
Ttc21b A T 2: 66,018,614 (GRCm39) N1264K probably damaging Het
Vmn1r120 A T 7: 20,787,531 (GRCm39) V60E possibly damaging Het
Ylpm1 A G 12: 85,077,319 (GRCm39) E890G probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp934 T C 13: 62,666,370 (GRCm39) Y102C probably damaging Het
Other mutations in Slc6a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Slc6a21 APN 7 44,937,668 (GRCm39) missense probably benign 0.31
IGL01526:Slc6a21 APN 7 44,937,220 (GRCm39) missense probably damaging 1.00
IGL01670:Slc6a21 APN 7 44,937,557 (GRCm39) missense possibly damaging 0.91
IGL01975:Slc6a21 APN 7 44,937,275 (GRCm39) missense probably benign 0.28
IGL02064:Slc6a21 APN 7 44,935,883 (GRCm39) missense possibly damaging 0.71
IGL02441:Slc6a21 APN 7 44,937,505 (GRCm39) missense probably damaging 1.00
IGL02735:Slc6a21 APN 7 44,936,061 (GRCm39) splice site probably benign
IGL03097:Slc6a21 UTSW 7 44,937,592 (GRCm39) nonsense probably null
R0211:Slc6a21 UTSW 7 44,937,667 (GRCm39) missense possibly damaging 0.90
R0211:Slc6a21 UTSW 7 44,937,667 (GRCm39) missense possibly damaging 0.90
R0269:Slc6a21 UTSW 7 44,936,332 (GRCm39) nonsense probably null
R0336:Slc6a21 UTSW 7 44,935,892 (GRCm39) missense probably damaging 1.00
R1077:Slc6a21 UTSW 7 44,937,626 (GRCm39) missense probably benign 0.42
R1476:Slc6a21 UTSW 7 44,922,052 (GRCm39) missense probably benign 0.09
R1763:Slc6a21 UTSW 7 44,937,158 (GRCm39) nonsense probably null
R1792:Slc6a21 UTSW 7 44,930,155 (GRCm39) missense probably benign 0.04
R1796:Slc6a21 UTSW 7 44,930,179 (GRCm39) missense probably damaging 1.00
R1812:Slc6a21 UTSW 7 44,932,371 (GRCm39) missense probably damaging 1.00
R1868:Slc6a21 UTSW 7 44,937,252 (GRCm39) missense probably benign 0.13
R2121:Slc6a21 UTSW 7 44,937,886 (GRCm39) missense probably benign 0.04
R2129:Slc6a21 UTSW 7 44,932,197 (GRCm39) splice site probably null
R2294:Slc6a21 UTSW 7 44,929,952 (GRCm39) missense possibly damaging 0.83
R2295:Slc6a21 UTSW 7 44,929,952 (GRCm39) missense possibly damaging 0.83
R2409:Slc6a21 UTSW 7 44,929,750 (GRCm39) missense probably benign 0.15
R2858:Slc6a21 UTSW 7 44,929,952 (GRCm39) missense possibly damaging 0.83
R3498:Slc6a21 UTSW 7 44,930,266 (GRCm39) missense probably damaging 1.00
R3751:Slc6a21 UTSW 7 44,929,928 (GRCm39) missense probably benign
R4297:Slc6a21 UTSW 7 44,937,186 (GRCm39) missense possibly damaging 0.95
R4510:Slc6a21 UTSW 7 44,936,713 (GRCm39) missense probably damaging 1.00
R4511:Slc6a21 UTSW 7 44,936,713 (GRCm39) missense probably damaging 1.00
R4876:Slc6a21 UTSW 7 44,929,535 (GRCm39) nonsense probably null
R4921:Slc6a21 UTSW 7 44,937,734 (GRCm39) missense possibly damaging 0.53
R5485:Slc6a21 UTSW 7 44,931,966 (GRCm39) critical splice donor site probably null
R5559:Slc6a21 UTSW 7 44,937,853 (GRCm39) missense possibly damaging 0.61
R6390:Slc6a21 UTSW 7 44,936,426 (GRCm39) missense probably benign 0.02
R6571:Slc6a21 UTSW 7 44,930,303 (GRCm39) missense probably damaging 0.99
R6792:Slc6a21 UTSW 7 44,929,309 (GRCm39) start codon destroyed probably null 0.02
R7235:Slc6a21 UTSW 7 44,930,182 (GRCm39) missense probably damaging 0.99
R7278:Slc6a21 UTSW 7 44,931,904 (GRCm39) missense possibly damaging 0.84
R7808:Slc6a21 UTSW 7 44,932,360 (GRCm39) missense
R9047:Slc6a21 UTSW 7 44,936,398 (GRCm39) missense
R9127:Slc6a21 UTSW 7 44,929,674 (GRCm39) splice site probably benign
R9299:Slc6a21 UTSW 7 44,937,130 (GRCm39) missense
R9524:Slc6a21 UTSW 7 44,937,785 (GRCm39) missense probably benign
R9640:Slc6a21 UTSW 7 44,937,189 (GRCm39) missense
R9748:Slc6a21 UTSW 7 44,929,941 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATACTGGTAAGTGTGGGC -3'
(R):5'- TCAGGACCAGCACCTCTATC -3'

Sequencing Primer
(F):5'- CTGGCAGAGACCCAAGTCC -3'
(R):5'- CCATTTGATTGGAGGCTTGAAG -3'
Posted On 2018-04-02