Incidental Mutation 'R6305:Enpp1'
ID509605
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 1
SynonymsPC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R6305 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location24637914-24712159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24641882 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 882 (Y882C)
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105520
AA Change: Y881C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: Y881C

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135846
AA Change: Y882C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: Y882C

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,980 S977P probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adcy6 T A 15: 98,598,645 I550L probably benign Het
Agbl3 G A 6: 34,782,210 D19N unknown Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgap39 T A 15: 76,737,702 D233V probably benign Het
Bcl9 G A 3: 97,205,938 P1067L possibly damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Casd1 C T 6: 4,641,892 T723I probably damaging Het
Cd209g T A 8: 4,136,809 I118N probably benign Het
Cdh24 A T 14: 54,632,356 D701E possibly damaging Het
Chd9 C T 8: 91,030,546 P1858S possibly damaging Het
Csnk1g3 T A 18: 53,932,312 Y322* probably null Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
D130043K22Rik T C 13: 24,885,685 F909S probably damaging Het
Dll4 T A 2: 119,330,657 S299T probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg4 T A 18: 20,449,790 Y162N probably damaging Het
Fam129a T C 1: 151,695,718 L248P probably damaging Het
Fbxw7 T A 3: 84,976,323 N520K probably damaging Het
Galc C T 12: 98,259,290 A14T possibly damaging Het
Gm11492 C T 11: 87,567,319 T173M probably benign Het
Grm7 G A 6: 111,358,665 R679Q probably damaging Het
Hnrnpdl T C 5: 100,038,658 probably benign Het
Il12a A T 3: 68,694,178 K77N possibly damaging Het
Il17rd C T 14: 27,095,942 S196L possibly damaging Het
Kcnv2 T C 19: 27,323,837 F363L probably benign Het
Lair1 A G 7: 4,010,728 probably null Het
Lrit3 G A 3: 129,800,460 T156I probably damaging Het
Me2 T A 18: 73,791,844 R267S probably benign Het
Mga T C 2: 119,947,698 V1908A probably benign Het
Mylk3 T A 8: 85,350,419 I463F probably damaging Het
Neb G A 2: 52,251,763 R75* probably null Het
Olfr1080 A G 2: 86,553,495 S210P possibly damaging Het
Olfr339 T A 2: 36,421,622 S75T probably damaging Het
Olfr469 T G 7: 107,822,657 T271P probably benign Het
Olfr516 C T 7: 108,845,554 G152D possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TG TGGTGTTGG 9: 38,026,542 probably null Het
Pfas A G 11: 69,001,197 S162P possibly damaging Het
Pip5k1c T A 10: 81,315,934 V654E probably benign Het
Plxdc1 C A 11: 97,938,590 C318F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rexo5 A T 7: 119,828,125 K419N probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc24a4 C A 12: 102,222,101 T151K possibly damaging Het
Slc6a15 A T 10: 103,389,170 I40F probably benign Het
Slc6a21 T C 7: 45,280,604 V172A possibly damaging Het
Thrap3 A G 4: 126,180,807 probably benign Het
Tm9sf3 A G 19: 41,245,442 probably null Het
Trp53 A T 11: 69,588,707 H211L probably damaging Het
Ttc21b A T 2: 66,188,270 N1264K probably damaging Het
Vmn1r120 A T 7: 21,053,606 V60E possibly damaging Het
Ylpm1 A G 12: 85,030,545 E890G probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp934 T C 13: 62,518,556 Y102C probably damaging Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24645427 missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24654031 missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24664614 missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24655856 missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24641961 missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24679185 splice site probably benign
IGL02691:Enpp1 APN 10 24711892 missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24660274 missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24655881 splice site probably benign
IGL03330:Enpp1 APN 10 24664906 splice site probably benign
IGL03365:Enpp1 APN 10 24669025 missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24660283 critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24653950 missense probably benign 0.16
R0011:Enpp1 UTSW 10 24670002 nonsense probably null
R0201:Enpp1 UTSW 10 24653917 missense probably benign 0.00
R0496:Enpp1 UTSW 10 24672052 missense probably benign 0.18
R1228:Enpp1 UTSW 10 24645412 missense probably benign 0.30
R1536:Enpp1 UTSW 10 24641834 missense probably benign 0.27
R1927:Enpp1 UTSW 10 24654888 missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24711804 critical splice donor site probably null
R2057:Enpp1 UTSW 10 24660192 missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24651341 missense probably benign 0.24
R4077:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4079:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4739:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4740:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4761:Enpp1 UTSW 10 24641951 missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24661935 missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24648085 missense probably benign 0.01
R5140:Enpp1 UTSW 10 24652852 missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24651390 missense probably benign
R5421:Enpp1 UTSW 10 24669757 missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24654908 missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24654919 missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24647239 missense probably benign
R5942:Enpp1 UTSW 10 24676068 nonsense probably null
R6048:Enpp1 UTSW 10 24660254 missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24657126 missense possibly damaging 0.93
R6319:Enpp1 UTSW 10 24648031 missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24669755 nonsense probably null
R6793:Enpp1 UTSW 10 24655825 missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24651339 missense probably benign 0.30
R7255:Enpp1 UTSW 10 24645315 missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24660161 missense probably benign 0.01
R7401:Enpp1 UTSW 10 24645282 missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7430:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7526:Enpp1 UTSW 10 24674410 intron probably null
R7532:Enpp1 UTSW 10 24675987 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CAGTTGTAACTCCACTCGACC -3'
(R):5'- GTCATTTCTCAGCCTAAAATGTCC -3'

Sequencing Primer
(F):5'- CGTTTCCAAACAATGCAAAAGTG -3'
(R):5'- TCCTAAGTAAATAAGCTGAGAAGAGG -3'
Posted On2018-04-02