Mutagenetix > Incidental Mutations

Incidental Mutation 'R6305:Pip5k1c'

509606

Institutional Source

Beutler Lab

Gene Symbol

Pip5k1c

Ensembl Gene

ENSMUSG00000034902

Gene Name

phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma

Synonyms

PIP5KIgamma

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6305 (G1)

Quality Score

194.009

Status

Validated

Chromosome

Chromosomal Location

81292963-81319973 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81315934 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 654 (V654E)

Ref Sequence

ENSEMBL: ENSMUSP00000038225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000161719] [ENSMUST00000161854] [ENSMUST00000161869] [ENSMUST00000163075]

Predicted Effect

probably benign
Transcript: ENSMUST00000045469
AA Change: V654E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: V654E

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
PIPKc	103	444	2.72e-164	SMART
low complexity region	518	534	N/A	INTRINSIC
low complexity region	575	591	N/A	INTRINSIC
low complexity region	601	628	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105327

SMART Domains

Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
PIPKc	103	444	2.72e-164	SMART
low complexity region	518	534	N/A	INTRINSIC
low complexity region	575	591	N/A	INTRINSIC
low complexity region	601	628	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159636

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159895

Predicted Effect

probably benign
Transcript: ENSMUST00000161586

SMART Domains

Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	28	44	N/A	INTRINSIC
low complexity region	54	81	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161719

SMART Domains

Protein: ENSMUSP00000125461
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
Pfam:PIP5K	1	133	1.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161854

SMART Domains

Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161869

SMART Domains

Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	7	36	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163075

SMART Domains

Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
PIPKc	103	444	2.72e-164	SMART
low complexity region	518	534	N/A	INTRINSIC
low complexity region	575	591	N/A	INTRINSIC
low complexity region	601	628	N/A	INTRINSIC

Meta Mutation Damage Score

0.0717

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,067,980	S977P	probably damaging	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
Adcy6	T	A	15: 98,598,645	I550L	probably benign	Het
Agbl3	G	A	6: 34,782,210	D19N	unknown	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arhgap39	T	A	15: 76,737,702	D233V	probably benign	Het
Bcl9	G	A	3: 97,205,938	P1067L	possibly damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Casd1	C	T	6: 4,641,892	T723I	probably damaging	Het
Cd209g	T	A	8: 4,136,809	I118N	probably benign	Het
Cdh24	A	T	14: 54,632,356	D701E	possibly damaging	Het
Chd9	C	T	8: 91,030,546	P1858S	possibly damaging	Het
Csnk1g3	T	A	18: 53,932,312	Y322*	probably null	Het
Cyp2f2	G	A	7: 27,129,224	R173H	probably damaging	Het
D130043K22Rik	T	C	13: 24,885,685	F909S	probably damaging	Het
Dll4	T	A	2: 119,330,657	S299T	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Dsg4	T	A	18: 20,449,790	Y162N	probably damaging	Het
Enpp1	T	C	10: 24,641,882	Y882C	probably damaging	Het
Fam129a	T	C	1: 151,695,718	L248P	probably damaging	Het
Fbxw7	T	A	3: 84,976,323	N520K	probably damaging	Het
Galc	C	T	12: 98,259,290	A14T	possibly damaging	Het
Gm11492	C	T	11: 87,567,319	T173M	probably benign	Het
Grm7	G	A	6: 111,358,665	R679Q	probably damaging	Het
Hnrnpdl	T	C	5: 100,038,658		probably benign	Het
Il12a	A	T	3: 68,694,178	K77N	possibly damaging	Het
Il17rd	C	T	14: 27,095,942	S196L	possibly damaging	Het
Kcnv2	T	C	19: 27,323,837	F363L	probably benign	Het
Lair1	A	G	7: 4,010,728		probably null	Het
Lrit3	G	A	3: 129,800,460	T156I	probably damaging	Het
Me2	T	A	18: 73,791,844	R267S	probably benign	Het
Mga	T	C	2: 119,947,698	V1908A	probably benign	Het
Mylk3	T	A	8: 85,350,419	I463F	probably damaging	Het
Neb	G	A	2: 52,251,763	R75*	probably null	Het
Olfr1080	A	G	2: 86,553,495	S210P	possibly damaging	Het
Olfr339	T	A	2: 36,421,622	S75T	probably damaging	Het
Olfr469	T	G	7: 107,822,657	T271P	probably benign	Het
Olfr516	C	T	7: 108,845,554	G152D	possibly damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Olfr883	TG	TGGTGTTGG	9: 38,026,542		probably null	Het
Pfas	A	G	11: 69,001,197	S162P	possibly damaging	Het
Plxdc1	C	A	11: 97,938,590	C318F	probably damaging	Het
Rbm8a2	T	C	1: 175,978,746	D55G	probably benign	Het
Rexo5	A	T	7: 119,828,125	K419N	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc24a4	C	A	12: 102,222,101	T151K	possibly damaging	Het
Slc6a15	A	T	10: 103,389,170	I40F	probably benign	Het
Slc6a21	T	C	7: 45,280,604	V172A	possibly damaging	Het
Thrap3	A	G	4: 126,180,807		probably benign	Het
Tm9sf3	A	G	19: 41,245,442		probably null	Het
Trp53	A	T	11: 69,588,707	H211L	probably damaging	Het
Ttc21b	A	T	2: 66,188,270	N1264K	probably damaging	Het
Vmn1r120	A	T	7: 21,053,606	V60E	possibly damaging	Het
Ylpm1	A	G	12: 85,030,545	E890G	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp934	T	C	13: 62,518,556	Y102C	probably damaging	Het

Other mutations in Pip5k1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Pip5k1c	APN	10	81305711	missense	probably benign	0.45
IGL02274:Pip5k1c	APN	10	81306384	missense	probably damaging	1.00
IGL02500:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02565:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02577:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02579:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02581:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02604:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02610:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02613:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02616:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02617:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02639:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02641:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02642:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02724:Pip5k1c	APN	10	81313462	missense	probably benign	0.01
IGL02751:Pip5k1c	APN	10	81317321	splice site	probably null
PIT4366001:Pip5k1c	UTSW	10	81309008	missense	probably damaging	0.98
R0257:Pip5k1c	UTSW	10	81315096	missense	possibly damaging	0.86
R1643:Pip5k1c	UTSW	10	81314994	missense	probably damaging	1.00
R1663:Pip5k1c	UTSW	10	81312515	missense	probably damaging	1.00
R1872:Pip5k1c	UTSW	10	81306319	missense	probably damaging	0.99
R2293:Pip5k1c	UTSW	10	81314084	missense	possibly damaging	0.82
R2295:Pip5k1c	UTSW	10	81305186	missense	probably benign	0.40
R2310:Pip5k1c	UTSW	10	81306308	missense	probably damaging	0.96
R2406:Pip5k1c	UTSW	10	81309024	missense	probably damaging	1.00
R4504:Pip5k1c	UTSW	10	81315111	missense	probably damaging	0.98
R4772:Pip5k1c	UTSW	10	81315940	missense	probably benign
R5022:Pip5k1c	UTSW	10	81310889	splice site	probably null
R5023:Pip5k1c	UTSW	10	81310889	splice site	probably null
R5033:Pip5k1c	UTSW	10	81305250	missense	probably damaging	0.99
R5057:Pip5k1c	UTSW	10	81310889	splice site	probably null
R5482:Pip5k1c	UTSW	10	81293063	missense	probably damaging	0.98
R6511:Pip5k1c	UTSW	10	81310817	missense	probably damaging	1.00
R6544:Pip5k1c	UTSW	10	81308996	missense	probably damaging	1.00
R7512:Pip5k1c	UTSW	10	81315119	critical splice donor site	probably null
R7581:Pip5k1c	UTSW	10	81308960	missense	probably damaging	1.00
R8218:Pip5k1c	UTSW	10	81306416	missense	probably damaging	1.00
Z1177:Pip5k1c	UTSW	10	81315032	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- TTATGGGATCCCTAGTCCCCAAC -3'
(R):5'- TAAGCTGGGGTACTGCAGAC -3'

Sequencing Primer
(F):5'- AGCCACACATCCTGCTTCCG -3'
(R):5'- TACTGCAGACCTGGCTTGG -3'

Posted On

2018-04-02