Incidental Mutation 'R6305:Slc13a2'
ID 509610
Institutional Source Beutler Lab
Gene Symbol Slc13a2
Ensembl Gene ENSMUSG00000001095
Gene Name solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
Synonyms sodium/dicarboxylate co-transporter, mNaDC-1, Nadc1
MMRRC Submission 044411-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6305 (G1)
Quality Score 217.468
Status Validated
Chromosome 11
Chromosomal Location 78288102-78313107 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) CGTTATCTGT to CGT at 78294306 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001122]
AlphaFold Q9ES88
Predicted Effect probably benign
Transcript: ENSMUST00000001122
SMART Domains Protein: ENSMUSP00000001122
Gene: ENSMUSG00000001095

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 560 7.1e-161 PFAM
Pfam:CitMHS 45 164 3e-15 PFAM
Pfam:CitMHS 203 499 1.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149865
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-coupled citrate transporter that is regulated by the chaperone activity of cyclophilin b. The encoded protein may play a role in the formation of kidney stones. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Kreb cycle intermediates in the urine but otherwise have normal kidney function and response to ischemia-reperfusion injury and caloric restriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,773,741 (GRCm39) S977P probably damaging Het
Abraxas2 G A 7: 132,476,694 (GRCm39) A145T probably damaging Het
Adcy6 T A 15: 98,496,526 (GRCm39) I550L probably benign Het
Agbl3 G A 6: 34,759,145 (GRCm39) D19N unknown Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Arhgap39 T A 15: 76,621,902 (GRCm39) D233V probably benign Het
Bcl9 G A 3: 97,113,254 (GRCm39) P1067L possibly damaging Het
Casd1 C T 6: 4,641,892 (GRCm39) T723I probably damaging Het
Cd209g T A 8: 4,186,809 (GRCm39) I118N probably benign Het
Cdh24 A T 14: 54,869,813 (GRCm39) D701E possibly damaging Het
Chd9 C T 8: 91,757,174 (GRCm39) P1858S possibly damaging Het
Csnk1g3 T A 18: 54,065,384 (GRCm39) Y322* probably null Het
Cyp2f2 G A 7: 26,828,649 (GRCm39) R173H probably damaging Het
D130043K22Rik T C 13: 25,069,668 (GRCm39) F909S probably damaging Het
Dll4 T A 2: 119,161,138 (GRCm39) S299T probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dsg4 T A 18: 20,582,847 (GRCm39) Y162N probably damaging Het
Enpp1 T C 10: 24,517,780 (GRCm39) Y882C probably damaging Het
Fbxw7 T A 3: 84,883,630 (GRCm39) N520K probably damaging Het
Galc C T 12: 98,225,549 (GRCm39) A14T possibly damaging Het
Grm7 G A 6: 111,335,626 (GRCm39) R679Q probably damaging Het
Hnrnpdl T C 5: 100,186,517 (GRCm39) probably benign Het
Il12a A T 3: 68,601,511 (GRCm39) K77N possibly damaging Het
Il17rd C T 14: 26,817,899 (GRCm39) S196L possibly damaging Het
Kcnv2 T C 19: 27,301,237 (GRCm39) F363L probably benign Het
Lair1 A G 7: 4,013,727 (GRCm39) probably null Het
Lrit3 G A 3: 129,594,109 (GRCm39) T156I probably damaging Het
Me2 T A 18: 73,924,915 (GRCm39) R267S probably benign Het
Mga T C 2: 119,778,179 (GRCm39) V1908A probably benign Het
Mylk3 T A 8: 86,077,048 (GRCm39) I463F probably damaging Het
Neb G A 2: 52,141,775 (GRCm39) R75* probably null Het
Niban1 T C 1: 151,571,469 (GRCm39) L248P probably damaging Het
Or10a3b C T 7: 108,444,761 (GRCm39) G152D possibly damaging Het
Or1j11 T A 2: 36,311,634 (GRCm39) S75T probably damaging Het
Or5p50 T G 7: 107,421,864 (GRCm39) T271P probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or8b36 TG TGGTGTTGG 9: 37,937,838 (GRCm39) probably null Het
Or8k33 A G 2: 86,383,839 (GRCm39) S210P possibly damaging Het
Pfas A G 11: 68,892,023 (GRCm39) S162P possibly damaging Het
Pip5k1c T A 10: 81,151,768 (GRCm39) V654E probably benign Het
Plxdc1 C A 11: 97,829,416 (GRCm39) C318F probably damaging Het
Qrfprl A T 6: 65,431,975 (GRCm39) M293L probably benign Het
Rbm8a2 T C 1: 175,806,312 (GRCm39) D55G probably benign Het
Rexo5 A T 7: 119,427,348 (GRCm39) K419N probably damaging Het
Septin4 C T 11: 87,458,145 (GRCm39) T173M probably benign Het
Slc24a4 C A 12: 102,188,360 (GRCm39) T151K possibly damaging Het
Slc6a15 A T 10: 103,225,031 (GRCm39) I40F probably benign Het
Slc6a21 T C 7: 44,930,028 (GRCm39) V172A possibly damaging Het
Thrap3 A G 4: 126,074,600 (GRCm39) probably benign Het
Tm9sf3 A G 19: 41,233,881 (GRCm39) probably null Het
Trp53 A T 11: 69,479,533 (GRCm39) H211L probably damaging Het
Ttc21b A T 2: 66,018,614 (GRCm39) N1264K probably damaging Het
Vmn1r120 A T 7: 20,787,531 (GRCm39) V60E possibly damaging Het
Ylpm1 A G 12: 85,077,319 (GRCm39) E890G probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp934 T C 13: 62,666,370 (GRCm39) Y102C probably damaging Het
Other mutations in Slc13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Slc13a2 APN 11 78,291,374 (GRCm39) missense probably damaging 1.00
IGL01604:Slc13a2 APN 11 78,294,221 (GRCm39) missense possibly damaging 0.82
IGL01679:Slc13a2 APN 11 78,295,537 (GRCm39) missense probably damaging 1.00
IGL03100:Slc13a2 APN 11 78,295,299 (GRCm39) missense probably damaging 1.00
IGL03380:Slc13a2 APN 11 78,289,908 (GRCm39) missense probably benign 0.03
deliberate UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
Familiaris UTSW 11 78,295,621 (GRCm39) missense probably damaging 1.00
intentional UTSW 11 78,295,534 (GRCm39) missense probably damaging 1.00
R0085:Slc13a2 UTSW 11 78,297,694 (GRCm39) missense probably damaging 0.96
R0324:Slc13a2 UTSW 11 78,295,350 (GRCm39) missense probably damaging 1.00
R0368:Slc13a2 UTSW 11 78,295,626 (GRCm39) nonsense probably null
R0440:Slc13a2 UTSW 11 78,294,001 (GRCm39) missense probably benign 0.05
R0539:Slc13a2 UTSW 11 78,289,964 (GRCm39) missense probably damaging 1.00
R1519:Slc13a2 UTSW 11 78,288,572 (GRCm39) missense possibly damaging 0.59
R1550:Slc13a2 UTSW 11 78,293,990 (GRCm39) missense probably damaging 1.00
R1909:Slc13a2 UTSW 11 78,290,968 (GRCm39) missense possibly damaging 0.90
R2166:Slc13a2 UTSW 11 78,293,901 (GRCm39) missense probably benign 0.16
R2994:Slc13a2 UTSW 11 78,295,563 (GRCm39) missense probably damaging 1.00
R2998:Slc13a2 UTSW 11 78,295,611 (GRCm39) missense probably damaging 0.99
R3418:Slc13a2 UTSW 11 78,291,666 (GRCm39) missense probably benign 0.05
R3932:Slc13a2 UTSW 11 78,289,226 (GRCm39) missense probably damaging 1.00
R4233:Slc13a2 UTSW 11 78,294,361 (GRCm39) intron probably benign
R4462:Slc13a2 UTSW 11 78,295,213 (GRCm39) missense probably benign 0.44
R5014:Slc13a2 UTSW 11 78,290,987 (GRCm39) missense possibly damaging 0.73
R5170:Slc13a2 UTSW 11 78,291,634 (GRCm39) missense probably damaging 1.00
R5484:Slc13a2 UTSW 11 78,295,648 (GRCm39) splice site probably benign
R5809:Slc13a2 UTSW 11 78,288,647 (GRCm39) missense probably damaging 1.00
R5973:Slc13a2 UTSW 11 78,291,358 (GRCm39) missense probably damaging 0.99
R6243:Slc13a2 UTSW 11 78,295,534 (GRCm39) missense probably damaging 1.00
R6263:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6275:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6276:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6279:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6280:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6300:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6314:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6673:Slc13a2 UTSW 11 78,288,657 (GRCm39) missense probably benign 0.12
R7138:Slc13a2 UTSW 11 78,289,950 (GRCm39) missense possibly damaging 0.76
R7382:Slc13a2 UTSW 11 78,295,621 (GRCm39) missense probably damaging 1.00
R7657:Slc13a2 UTSW 11 78,289,223 (GRCm39) missense probably damaging 0.99
R7791:Slc13a2 UTSW 11 78,312,890 (GRCm39) critical splice donor site probably null
R8027:Slc13a2 UTSW 11 78,295,582 (GRCm39) missense probably benign 0.00
R9091:Slc13a2 UTSW 11 78,295,258 (GRCm39) missense probably damaging 1.00
R9270:Slc13a2 UTSW 11 78,295,258 (GRCm39) missense probably damaging 1.00
R9484:Slc13a2 UTSW 11 78,294,233 (GRCm39) missense probably damaging 0.97
R9501:Slc13a2 UTSW 11 78,291,633 (GRCm39) missense probably damaging 1.00
R9783:Slc13a2 UTSW 11 78,294,177 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCCATTTGTCACTCAGTG -3'
(R):5'- TAGGACCCTTCATTCCCAGC -3'

Sequencing Primer
(F):5'- AGAGTGCAAGCCCCCTTTTG -3'
(R):5'- TTCCCAGCAATCCAAGAGTTTG -3'
Posted On 2018-04-02