Incidental Mutation 'R6305:Gm11492'
ID509611
Institutional Source Beutler Lab
Gene Symbol Gm11492
Ensembl Gene ENSMUSG00000090107
Gene Namepredicted gene 11492
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R6305 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87566653-87569250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87567319 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 173 (T173M)
Ref Sequence ENSEMBL: ENSMUSP00000053087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060360] [ENSMUST00000122945]
Predicted Effect probably benign
Transcript: ENSMUST00000060360
AA Change: T173M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053087
Gene: ENSMUSG00000090107
AA Change: T173M

DomainStartEndE-ValueType
Pfam:DUF4655 13 369 1.7e-99 PFAM
Pfam:DUF4655 366 509 2.7e-68 PFAM
low complexity region 511 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,980 S977P probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adcy6 T A 15: 98,598,645 I550L probably benign Het
Agbl3 G A 6: 34,782,210 D19N unknown Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgap39 T A 15: 76,737,702 D233V probably benign Het
Bcl9 G A 3: 97,205,938 P1067L possibly damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Casd1 C T 6: 4,641,892 T723I probably damaging Het
Cd209g T A 8: 4,136,809 I118N probably benign Het
Cdh24 A T 14: 54,632,356 D701E possibly damaging Het
Chd9 C T 8: 91,030,546 P1858S possibly damaging Het
Csnk1g3 T A 18: 53,932,312 Y322* probably null Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
D130043K22Rik T C 13: 24,885,685 F909S probably damaging Het
Dll4 T A 2: 119,330,657 S299T probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg4 T A 18: 20,449,790 Y162N probably damaging Het
Enpp1 T C 10: 24,641,882 Y882C probably damaging Het
Fam129a T C 1: 151,695,718 L248P probably damaging Het
Fbxw7 T A 3: 84,976,323 N520K probably damaging Het
Galc C T 12: 98,259,290 A14T possibly damaging Het
Grm7 G A 6: 111,358,665 R679Q probably damaging Het
Hnrnpdl T C 5: 100,038,658 probably benign Het
Il12a A T 3: 68,694,178 K77N possibly damaging Het
Il17rd C T 14: 27,095,942 S196L possibly damaging Het
Kcnv2 T C 19: 27,323,837 F363L probably benign Het
Lair1 A G 7: 4,010,728 probably null Het
Lrit3 G A 3: 129,800,460 T156I probably damaging Het
Me2 T A 18: 73,791,844 R267S probably benign Het
Mga T C 2: 119,947,698 V1908A probably benign Het
Mylk3 T A 8: 85,350,419 I463F probably damaging Het
Neb G A 2: 52,251,763 R75* probably null Het
Olfr1080 A G 2: 86,553,495 S210P possibly damaging Het
Olfr339 T A 2: 36,421,622 S75T probably damaging Het
Olfr469 T G 7: 107,822,657 T271P probably benign Het
Olfr516 C T 7: 108,845,554 G152D possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TG TGGTGTTGG 9: 38,026,542 probably null Het
Pfas A G 11: 69,001,197 S162P possibly damaging Het
Pip5k1c T A 10: 81,315,934 V654E probably benign Het
Plxdc1 C A 11: 97,938,590 C318F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rexo5 A T 7: 119,828,125 K419N probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc24a4 C A 12: 102,222,101 T151K possibly damaging Het
Slc6a15 A T 10: 103,389,170 I40F probably benign Het
Slc6a21 T C 7: 45,280,604 V172A possibly damaging Het
Thrap3 A G 4: 126,180,807 probably benign Het
Tm9sf3 A G 19: 41,245,442 probably null Het
Trp53 A T 11: 69,588,707 H211L probably damaging Het
Ttc21b A T 2: 66,188,270 N1264K probably damaging Het
Vmn1r120 A T 7: 21,053,606 V60E possibly damaging Het
Ylpm1 A G 12: 85,030,545 E890G probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp934 T C 13: 62,518,556 Y102C probably damaging Het
Other mutations in Gm11492
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gm11492 APN 11 87568249 missense probably benign 0.07
IGL01993:Gm11492 APN 11 87567729 missense possibly damaging 0.85
IGL02566:Gm11492 APN 11 87567642 missense probably benign 0.00
IGL03213:Gm11492 APN 11 87567358 unclassified probably null
IGL03388:Gm11492 APN 11 87568216 nonsense probably null
R0050:Gm11492 UTSW 11 87567346 missense probably damaging 1.00
R1479:Gm11492 UTSW 11 87567418 missense probably damaging 1.00
R1851:Gm11492 UTSW 11 87568915 missense probably damaging 1.00
R1862:Gm11492 UTSW 11 87567235 missense possibly damaging 0.48
R1913:Gm11492 UTSW 11 87567012 missense probably benign
R3149:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R3176:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R3276:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R4021:Gm11492 UTSW 11 87567280 missense probably damaging 1.00
R4117:Gm11492 UTSW 11 87568282 missense probably damaging 1.00
R4332:Gm11492 UTSW 11 87567904 missense possibly damaging 0.95
R4515:Gm11492 UTSW 11 87568057 missense probably benign
R4663:Gm11492 UTSW 11 87567603 missense probably damaging 0.98
R4952:Gm11492 UTSW 11 87567772 missense probably benign 0.00
R5015:Gm11492 UTSW 11 87567217 missense possibly damaging 0.95
R5176:Gm11492 UTSW 11 87567532 missense probably benign 0.02
R5711:Gm11492 UTSW 11 87567897 missense probably benign 0.07
T0970:Gm11492 UTSW 11 87567732 missense probably damaging 0.98
Z1177:Gm11492 UTSW 11 87567922 missense not run
Predicted Primers PCR Primer
(F):5'- ACTTCACGGGGAACTGAGAC -3'
(R):5'- TGACCTCAGCAGTAGTCCTTC -3'

Sequencing Primer
(F):5'- AGAATAGAGGTGCCCTGCCATC -3'
(R):5'- CTCAGCAGTAGTCCTTCGGGTG -3'
Posted On2018-04-02