Incidental Mutation 'R6305:Ylpm1'
ID509613
Institutional Source Beutler Lab
Gene Symbol Ylpm1
Ensembl Gene ENSMUSG00000021244
Gene NameYLP motif containing 1
SynonymsZAP, A930013E17Rik, Zap3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6305 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location84996321-85070515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85030545 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 890 (E890G)
Ref Sequence ENSEMBL: ENSMUSP00000126347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000164558] [ENSMUST00000168977]
Predicted Effect probably damaging
Transcript: ENSMUST00000021670
AA Change: E1348G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244
AA Change: E1348G

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
internal_repeat_1 771 840 4.03e-5 PROSPERO
low complexity region 841 854 N/A INTRINSIC
low complexity region 966 972 N/A INTRINSIC
internal_repeat_1 1062 1124 4.03e-5 PROSPERO
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1326 1338 N/A INTRINSIC
low complexity region 1339 1353 N/A INTRINSIC
low complexity region 1408 1425 N/A INTRINSIC
coiled coil region 1447 1474 N/A INTRINSIC
low complexity region 1494 1517 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1557 N/A INTRINSIC
low complexity region 1598 1630 N/A INTRINSIC
low complexity region 1678 1694 N/A INTRINSIC
low complexity region 1705 1717 N/A INTRINSIC
low complexity region 1720 1736 N/A INTRINSIC
low complexity region 1797 1808 N/A INTRINSIC
Pfam:AAA_33 1829 1990 7.8e-11 PFAM
coiled coil region 1995 2032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101202
SMART Domains Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 206 N/A INTRINSIC
low complexity region 294 335 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
low complexity region 375 388 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 491 607 N/A INTRINSIC
low complexity region 641 649 N/A INTRINSIC
low complexity region 741 764 N/A INTRINSIC
low complexity region 765 779 N/A INTRINSIC
low complexity region 783 804 N/A INTRINSIC
low complexity region 845 877 N/A INTRINSIC
low complexity region 925 941 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 967 983 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
Pfam:AAA_33 1076 1265 4.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164558
AA Change: E890G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126347
Gene: ENSMUSG00000021244
AA Change: E890G

DomainStartEndE-ValueType
low complexity region 80 196 N/A INTRINSIC
low complexity region 230 238 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 508 514 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
coiled coil region 989 1016 N/A INTRINSIC
low complexity region 1036 1059 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1078 1099 N/A INTRINSIC
low complexity region 1140 1172 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
low complexity region 1262 1278 N/A INTRINSIC
low complexity region 1339 1350 N/A INTRINSIC
Pfam:AAA_33 1371 1559 5.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168977
SMART Domains Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 788 811 N/A INTRINSIC
low complexity region 812 826 N/A INTRINSIC
low complexity region 830 851 N/A INTRINSIC
low complexity region 892 924 N/A INTRINSIC
low complexity region 972 988 N/A INTRINSIC
low complexity region 999 1011 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:AAA_33 1123 1311 4.5e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,980 S977P probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adcy6 T A 15: 98,598,645 I550L probably benign Het
Agbl3 G A 6: 34,782,210 D19N unknown Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgap39 T A 15: 76,737,702 D233V probably benign Het
Bcl9 G A 3: 97,205,938 P1067L possibly damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Casd1 C T 6: 4,641,892 T723I probably damaging Het
Cd209g T A 8: 4,136,809 I118N probably benign Het
Cdh24 A T 14: 54,632,356 D701E possibly damaging Het
Chd9 C T 8: 91,030,546 P1858S possibly damaging Het
Csnk1g3 T A 18: 53,932,312 Y322* probably null Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
D130043K22Rik T C 13: 24,885,685 F909S probably damaging Het
Dll4 T A 2: 119,330,657 S299T probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg4 T A 18: 20,449,790 Y162N probably damaging Het
Enpp1 T C 10: 24,641,882 Y882C probably damaging Het
Fam129a T C 1: 151,695,718 L248P probably damaging Het
Fbxw7 T A 3: 84,976,323 N520K probably damaging Het
Galc C T 12: 98,259,290 A14T possibly damaging Het
Gm11492 C T 11: 87,567,319 T173M probably benign Het
Grm7 G A 6: 111,358,665 R679Q probably damaging Het
Hnrnpdl T C 5: 100,038,658 probably benign Het
Il12a A T 3: 68,694,178 K77N possibly damaging Het
Il17rd C T 14: 27,095,942 S196L possibly damaging Het
Kcnv2 T C 19: 27,323,837 F363L probably benign Het
Lair1 A G 7: 4,010,728 probably null Het
Lrit3 G A 3: 129,800,460 T156I probably damaging Het
Me2 T A 18: 73,791,844 R267S probably benign Het
Mga T C 2: 119,947,698 V1908A probably benign Het
Mylk3 T A 8: 85,350,419 I463F probably damaging Het
Neb G A 2: 52,251,763 R75* probably null Het
Olfr1080 A G 2: 86,553,495 S210P possibly damaging Het
Olfr339 T A 2: 36,421,622 S75T probably damaging Het
Olfr469 T G 7: 107,822,657 T271P probably benign Het
Olfr516 C T 7: 108,845,554 G152D possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TG TGGTGTTGG 9: 38,026,542 probably null Het
Pfas A G 11: 69,001,197 S162P possibly damaging Het
Pip5k1c T A 10: 81,315,934 V654E probably benign Het
Plxdc1 C A 11: 97,938,590 C318F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rexo5 A T 7: 119,828,125 K419N probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc24a4 C A 12: 102,222,101 T151K possibly damaging Het
Slc6a15 A T 10: 103,389,170 I40F probably benign Het
Slc6a21 T C 7: 45,280,604 V172A possibly damaging Het
Thrap3 A G 4: 126,180,807 probably benign Het
Tm9sf3 A G 19: 41,245,442 probably null Het
Trp53 A T 11: 69,588,707 H211L probably damaging Het
Ttc21b A T 2: 66,188,270 N1264K probably damaging Het
Vmn1r120 A T 7: 21,053,606 V60E possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp934 T C 13: 62,518,556 Y102C probably damaging Het
Other mutations in Ylpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ylpm1 APN 12 85028954 missense possibly damaging 0.93
IGL00809:Ylpm1 APN 12 85049194 missense probably damaging 0.99
IGL01508:Ylpm1 APN 12 85015455 missense possibly damaging 0.74
IGL02199:Ylpm1 APN 12 85034005 nonsense probably null
IGL02392:Ylpm1 APN 12 85014957 missense unknown
IGL02455:Ylpm1 APN 12 85030263 missense probably damaging 1.00
IGL02506:Ylpm1 APN 12 85049191 missense probably damaging 1.00
IGL03102:Ylpm1 APN 12 85049258 splice site probably benign
I1329:Ylpm1 UTSW 12 85040880 missense probably damaging 1.00
IGL02799:Ylpm1 UTSW 12 85044484 missense probably damaging 1.00
R0010:Ylpm1 UTSW 12 85029026 missense probably damaging 0.97
R0090:Ylpm1 UTSW 12 85029040 intron probably benign
R0149:Ylpm1 UTSW 12 85028838 missense probably damaging 0.99
R0226:Ylpm1 UTSW 12 85049737 missense probably benign 0.21
R0375:Ylpm1 UTSW 12 85014980 missense unknown
R0378:Ylpm1 UTSW 12 84997076 intron probably benign
R0507:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R0742:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R1350:Ylpm1 UTSW 12 85014082 unclassified probably benign
R1452:Ylpm1 UTSW 12 85030383 missense possibly damaging 0.94
R1500:Ylpm1 UTSW 12 85014996 missense unknown
R1837:Ylpm1 UTSW 12 85029333 missense possibly damaging 0.92
R1945:Ylpm1 UTSW 12 85015418 missense probably damaging 0.98
R1971:Ylpm1 UTSW 12 85040786 missense probably damaging 1.00
R2211:Ylpm1 UTSW 12 85044378 nonsense probably null
R2213:Ylpm1 UTSW 12 85069718 missense probably benign 0.25
R2269:Ylpm1 UTSW 12 85015050 missense unknown
R2300:Ylpm1 UTSW 12 85060319 splice site probably null
R2439:Ylpm1 UTSW 12 85014117 unclassified probably benign
R2497:Ylpm1 UTSW 12 84996761 missense probably damaging 0.98
R2890:Ylpm1 UTSW 12 85029813 missense probably damaging 0.99
R3111:Ylpm1 UTSW 12 85029371 missense probably damaging 0.98
R3436:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R3437:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R4156:Ylpm1 UTSW 12 85057403 intron probably benign
R4157:Ylpm1 UTSW 12 85057403 intron probably benign
R4959:Ylpm1 UTSW 12 85049945 missense probably damaging 1.00
R5014:Ylpm1 UTSW 12 85014749 missense unknown
R5039:Ylpm1 UTSW 12 85015493 missense probably damaging 0.98
R5039:Ylpm1 UTSW 12 85042239 missense probably damaging 1.00
R5084:Ylpm1 UTSW 12 85029321 missense probably damaging 0.99
R5325:Ylpm1 UTSW 12 85013961 unclassified probably benign
R5378:Ylpm1 UTSW 12 85030255 missense probably damaging 0.99
R5428:Ylpm1 UTSW 12 85030229 missense probably benign 0.04
R5467:Ylpm1 UTSW 12 84996859 missense unknown
R5605:Ylpm1 UTSW 12 85028853 missense probably damaging 1.00
R5614:Ylpm1 UTSW 12 85064944 intron probably benign
R5748:Ylpm1 UTSW 12 85060251 splice site probably null
R5860:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5861:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5881:Ylpm1 UTSW 12 85042125 missense probably damaging 1.00
R5909:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5912:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5915:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R6000:Ylpm1 UTSW 12 84997256 missense unknown
R6004:Ylpm1 UTSW 12 85029084 missense possibly damaging 0.78
R6007:Ylpm1 UTSW 12 85029290 missense probably benign 0.33
R6053:Ylpm1 UTSW 12 84996503 missense possibly damaging 0.72
R6104:Ylpm1 UTSW 12 85029630 missense probably benign 0.00
R6197:Ylpm1 UTSW 12 85042179 missense probably damaging 1.00
R6293:Ylpm1 UTSW 12 85015277 missense unknown
R6297:Ylpm1 UTSW 12 85015277 missense unknown
R6379:Ylpm1 UTSW 12 85030800 missense probably damaging 1.00
R6465:Ylpm1 UTSW 12 85049802 missense probably damaging 1.00
R6608:Ylpm1 UTSW 12 85015277 missense unknown
R6609:Ylpm1 UTSW 12 85015277 missense unknown
R6737:Ylpm1 UTSW 12 85030846 missense probably damaging 0.98
R6794:Ylpm1 UTSW 12 84996881 missense unknown
R7383:Ylpm1 UTSW 12 85044468 missense possibly damaging 0.93
R7514:Ylpm1 UTSW 12 85030494 missense possibly damaging 0.94
R7577:Ylpm1 UTSW 12 84997220 missense unknown
R7709:Ylpm1 UTSW 12 85013025 missense unknown
R7718:Ylpm1 UTSW 12 85029122 missense probably damaging 0.99
Z1088:Ylpm1 UTSW 12 85030155 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCATCACGGTCTCATGATGG -3'
(R):5'- AGGATGGCATATGTTCCGCC -3'

Sequencing Primer
(F):5'- GATCGCATTAGAAGACCTTTGG -3'
(R):5'- CATGGGGGAATGTCTATCCACATC -3'
Posted On2018-04-02