Incidental Mutation 'R6305:Zfp647'
ID 509621
Institutional Source Beutler Lab
Gene Symbol Zfp647
Ensembl Gene ENSMUSG00000054967
Gene Name zinc finger protein 647
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R6305 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 76910371-76925448 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 76912085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 125 (P125L)
Ref Sequence ENSEMBL: ENSMUSP00000155272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048854] [ENSMUST00000229055] [ENSMUST00000229865]
AlphaFold Q7TNU6
Predicted Effect probably benign
Transcript: ENSMUST00000048854
AA Change: P125L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041575
Gene: ENSMUSG00000054967
AA Change: P125L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 17 77 7.05e-33 SMART
ZnF_C2H2 174 196 3.39e-3 SMART
ZnF_C2H2 202 224 1.2e-3 SMART
ZnF_C2H2 230 252 2.95e-3 SMART
ZnF_C2H2 258 280 4.79e-3 SMART
ZnF_C2H2 286 308 1.84e-4 SMART
ZnF_C2H2 314 336 6.32e-3 SMART
ZnF_C2H2 342 364 7.37e-4 SMART
ZnF_C2H2 370 392 1.6e-4 SMART
ZnF_C2H2 398 420 2.2e-2 SMART
ZnF_C2H2 426 448 6.78e-3 SMART
ZnF_C2H2 454 476 4.87e-4 SMART
ZnF_C2H2 482 504 2.24e-3 SMART
ZnF_C2H2 510 532 9.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229055
AA Change: P125L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably damaging
Transcript: ENSMUST00000229865
AA Change: P125L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1789 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,980 S977P probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adcy6 T A 15: 98,598,645 I550L probably benign Het
Agbl3 G A 6: 34,782,210 D19N unknown Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgap39 T A 15: 76,737,702 D233V probably benign Het
Bcl9 G A 3: 97,205,938 P1067L possibly damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Casd1 C T 6: 4,641,892 T723I probably damaging Het
Cd209g T A 8: 4,136,809 I118N probably benign Het
Cdh24 A T 14: 54,632,356 D701E possibly damaging Het
Chd9 C T 8: 91,030,546 P1858S possibly damaging Het
Csnk1g3 T A 18: 53,932,312 Y322* probably null Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
D130043K22Rik T C 13: 24,885,685 F909S probably damaging Het
Dll4 T A 2: 119,330,657 S299T probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg4 T A 18: 20,449,790 Y162N probably damaging Het
Enpp1 T C 10: 24,641,882 Y882C probably damaging Het
Fam129a T C 1: 151,695,718 L248P probably damaging Het
Fbxw7 T A 3: 84,976,323 N520K probably damaging Het
Galc C T 12: 98,259,290 A14T possibly damaging Het
Gm11492 C T 11: 87,567,319 T173M probably benign Het
Grm7 G A 6: 111,358,665 R679Q probably damaging Het
Hnrnpdl T C 5: 100,038,658 probably benign Het
Il12a A T 3: 68,694,178 K77N possibly damaging Het
Il17rd C T 14: 27,095,942 S196L possibly damaging Het
Kcnv2 T C 19: 27,323,837 F363L probably benign Het
Lair1 A G 7: 4,010,728 probably null Het
Lrit3 G A 3: 129,800,460 T156I probably damaging Het
Me2 T A 18: 73,791,844 R267S probably benign Het
Mga T C 2: 119,947,698 V1908A probably benign Het
Mylk3 T A 8: 85,350,419 I463F probably damaging Het
Neb G A 2: 52,251,763 R75* probably null Het
Olfr1080 A G 2: 86,553,495 S210P possibly damaging Het
Olfr339 T A 2: 36,421,622 S75T probably damaging Het
Olfr469 T G 7: 107,822,657 T271P probably benign Het
Olfr516 C T 7: 108,845,554 G152D possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TG TGGTGTTGG 9: 38,026,542 probably null Het
Pfas A G 11: 69,001,197 S162P possibly damaging Het
Pip5k1c T A 10: 81,315,934 V654E probably benign Het
Plxdc1 C A 11: 97,938,590 C318F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rexo5 A T 7: 119,828,125 K419N probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc24a4 C A 12: 102,222,101 T151K possibly damaging Het
Slc6a15 A T 10: 103,389,170 I40F probably benign Het
Slc6a21 T C 7: 45,280,604 V172A possibly damaging Het
Thrap3 A G 4: 126,180,807 probably benign Het
Tm9sf3 A G 19: 41,245,442 probably null Het
Trp53 A T 11: 69,588,707 H211L probably damaging Het
Ttc21b A T 2: 66,188,270 N1264K probably damaging Het
Vmn1r120 A T 7: 21,053,606 V60E possibly damaging Het
Ylpm1 A G 12: 85,030,545 E890G probably damaging Het
Zfp934 T C 13: 62,518,556 Y102C probably damaging Het
Other mutations in Zfp647
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:Zfp647 APN 15 76911670 nonsense probably null
IGL01680:Zfp647 APN 15 76917768 splice site probably benign
IGL02647:Zfp647 APN 15 76917715 missense probably damaging 1.00
IGL03213:Zfp647 APN 15 76911977 missense possibly damaging 0.46
IGL03401:Zfp647 APN 15 76911368 missense probably damaging 1.00
R0418:Zfp647 UTSW 15 76911386 missense probably damaging 1.00
R1479:Zfp647 UTSW 15 76911203 missense possibly damaging 0.94
R1913:Zfp647 UTSW 15 76911951 missense probably benign 0.02
R1959:Zfp647 UTSW 15 76911114 missense possibly damaging 0.57
R2176:Zfp647 UTSW 15 76911660 missense probably damaging 1.00
R3076:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3077:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3701:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3702:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3960:Zfp647 UTSW 15 76910976 splice site probably null
R4938:Zfp647 UTSW 15 76911044 frame shift probably null
R4939:Zfp647 UTSW 15 76911044 frame shift probably null
R5196:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5197:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5345:Zfp647 UTSW 15 76911495 missense possibly damaging 0.48
R5415:Zfp647 UTSW 15 76911393 missense possibly damaging 0.79
R5791:Zfp647 UTSW 15 76918006 missense unknown
R5942:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5944:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5945:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5946:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5947:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6005:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6007:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6073:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6074:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6101:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6102:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6103:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6126:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6127:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6129:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6136:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6151:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6306:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6329:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6721:Zfp647 UTSW 15 76911876 missense probably benign 0.00
R7158:Zfp647 UTSW 15 76917305 missense probably benign 0.01
R7239:Zfp647 UTSW 15 76911756 missense probably damaging 1.00
R7611:Zfp647 UTSW 15 76911788 missense probably damaging 1.00
R8066:Zfp647 UTSW 15 76911895 missense probably damaging 0.98
R8170:Zfp647 UTSW 15 76911371 missense possibly damaging 0.87
R8346:Zfp647 UTSW 15 76911728 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCGACCAAAGCACTTTC -3'
(R):5'- AGCCAGCATTAAGATTGTACTCAG -3'

Sequencing Primer
(F):5'- TTCCACACTCAATGCAGATATAGGG -3'
(R):5'- TTAAAGCAGCCCTTGTAGGTAGCC -3'
Posted On 2018-04-02