Mutagenetix > Incidental Mutation

Incidental Mutation 'R6306:Dnah14'

509635

Institutional Source

Beutler Lab

Gene Symbol

Dnah14

Ensembl Gene

ENSMUSG00000047369

Gene Name

dynein, axonemal, heavy chain 14

Synonyms

Dnahc14, Gm980, LOC381311, A230079K17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R6306 (G1)

Quality Score

217.468

Status

Validated

Chromosome

Chromosomal Location

181576559-181815774 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CTGTG to CTG at 181585024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000208001]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000208001

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	T	C	17: 23,706,150	N495S	possibly damaging	Het
Adamts7	G	A	9: 90,178,278		probably null	Het
Adora2a	T	A	10: 75,333,404	V234E	probably damaging	Het
Alpk1	T	C	3: 127,686,316	D188G	probably damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Ankrd17	A	G	5: 90,244,154	F1886L	probably benign	Het
Anks1	T	G	17: 28,050,639	L769R	probably damaging	Het
Apol10a	A	G	15: 77,488,961	I266V	probably benign	Het
Arhgef28	T	C	13: 97,985,388	Y556C	probably damaging	Het
Brd8	T	A	18: 34,611,251	T175S	probably damaging	Het
Camsap2	C	T	1: 136,281,199	V852I	probably benign	Het
Cd55b	G	T	1: 130,414,066	P278Q	probably damaging	Het
Cep290	T	A	10: 100,531,166	S1126R	possibly damaging	Het
Cfh	C	T	1: 140,102,417	C906Y	probably damaging	Het
Chst13	C	A	6: 90,309,278	R234L	probably damaging	Het
Clcn7	T	C	17: 25,157,528	F611L	probably benign	Het
Cntnap1	A	G	11: 101,184,615	D873G	probably damaging	Het
Cntnap5b	T	C	1: 100,164,146	I518T	probably damaging	Het
Col28a1	T	C	6: 8,014,969	E812G	probably damaging	Het
Cpa1	T	C	6: 30,640,954	I148T	probably damaging	Het
Cyp11a1	A	G	9: 58,025,100	N232S	probably benign	Het
Dhrs13	A	G	11: 78,032,693	D79G	probably damaging	Het
Disp1	T	C	1: 183,087,148	E1236G	possibly damaging	Het
Dnah1	A	C	14: 31,304,587	L778R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Dock9	A	T	14: 121,562,080	I1729N	probably damaging	Het
Dysf	T	C	6: 84,137,266	V1192A	possibly damaging	Het
Enpp2	A	G	15: 54,899,346	S169P	probably damaging	Het
Fam114a2	T	G	11: 57,514,146	R43S	probably damaging	Het
Fam13a	T	C	6: 58,940,254	T546A	probably benign	Het
Fos	A	T	12: 85,475,686	D163V	probably damaging	Het
Fras1	T	C	5: 96,764,946	Y3370H	probably damaging	Het
Fshr	T	C	17: 89,200,533	N27S	probably null	Het
Galnt6	A	G	15: 100,693,424	S600P	possibly damaging	Het
Gars	T	A	6: 55,055,824	N260K	probably damaging	Het
Gpr158	C	G	2: 21,815,611	P640A	possibly damaging	Het
Grik3	A	G	4: 125,632,412	D146G	probably benign	Het
Hdac4	T	C	1: 91,996,174	T205A	probably benign	Het
Kcnq3	T	C	15: 66,004,794	D500G	probably benign	Het
Kmt5c	A	G	7: 4,746,481	K333E	probably benign	Het
Krt81	A	G	15: 101,459,523	S443P	probably benign	Het
M6pr	T	C	6: 122,315,162		probably null	Het
Mccc2	T	A	13: 99,993,577	I91L	probably benign	Het
Nip7	A	G	8: 107,058,423	D110G	probably damaging	Het
Nol8	T	A	13: 49,676,353	F1093I	probably damaging	Het
Nrxn1	T	C	17: 90,565,446	T1027A	possibly damaging	Het
Ofcc1	T	A	13: 40,148,576	M495L	probably benign	Het
Olfr18	A	G	9: 20,314,446	M158T	probably benign	Het
Olfr62	A	T	4: 118,666,293	M259L	probably benign	Het
Pafah1b2	A	T	9: 45,975,127	V81D	probably damaging	Het
Pcdhga4	A	T	18: 37,685,913	S172C	probably damaging	Het
Pds5a	A	G	5: 65,656,296	V282A	probably damaging	Het
Plat	A	G	8: 22,772,266	D102G	possibly damaging	Het
Plce1	C	A	19: 38,769,465	Q1961K	probably damaging	Het
Plppr3	T	A	10: 79,861,732	K444*	probably null	Het
Plscr3	A	G	11: 69,847,646		probably null	Het
Prtg	A	T	9: 72,906,186	T943S	probably benign	Het
Racgap1	A	G	15: 99,623,953	F519L	probably benign	Het
Rbms2	A	T	10: 128,151,181		probably null	Het
Rfx7	A	G	9: 72,616,955	T476A	possibly damaging	Het
Rnf150	T	A	8: 83,083,502	L421Q	possibly damaging	Het
Sema3b	A	G	9: 107,600,920	L422P	possibly damaging	Het
Shank2	G	A	7: 144,409,680	A921T	probably benign	Het
Skint3	A	T	4: 112,255,875	E227D	probably damaging	Het
Slc25a19	G	A	11: 115,617,560	R201C	possibly damaging	Het
Slc38a10	G	T	11: 120,147,819	A40D	probably damaging	Het
Slc5a4b	T	C	10: 76,081,351	T284A	probably benign	Het
Smc1b	A	T	15: 85,127,623	F154I	probably benign	Het
Spry2	A	T	14: 105,892,984	M256K	possibly damaging	Het
Stkld1	C	T	2: 26,943,887	P129S	probably damaging	Het
Syce2	T	C	8: 84,872,742	L13S	possibly damaging	Het
Tbc1d15	C	A	10: 115,233,243	V74L	possibly damaging	Het
Tecpr2	T	A	12: 110,944,751	V1074D	probably damaging	Het
Tex36	G	A	7: 133,595,325	T21I	probably benign	Het
Ttn	T	G	2: 76,724,110	D30787A	probably damaging	Het
Ttn	T	A	2: 76,791,920	Q13710L	probably benign	Het
Usp34	T	C	11: 23,412,260	F1569L	possibly damaging	Het
Vat1l	C	T	8: 114,371,651	A387V	probably damaging	Het
Vil1	G	A	1: 74,421,311	G209D	possibly damaging	Het
Vmn1r113	G	T	7: 20,787,867	D195Y	probably damaging	Het
Vmn2r69	A	C	7: 85,415,591	I29R	probably benign	Het
Vti1b	G	A	12: 79,160,549	Q76*	probably null	Het
Zfp423	C	A	8: 87,782,034	V540F	possibly damaging	Het
Zfp644	T	C	5: 106,638,124	N186D	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp787	G	A	7: 6,132,361	A297V	probably damaging	Het
Zfp827	G	T	8: 79,060,695	Q163H	probably damaging	Het
Zfp955b	T	A	17: 33,303,186	V543E	probably benign	Het

Other mutations in Dnah14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Dnah14	APN	1	181752046	missense	probably benign	0.17
IGL01764:Dnah14	APN	1	181744777	missense	probably benign	0.00
IGL03218:Dnah14	APN	1	181755269	missense	probably benign	0.02
IGL03290:Dnah14	APN	1	181763978	splice site	probably benign
IGL03384:Dnah14	APN	1	181745949	missense	probably benign	0.03
R0009:Dnah14	UTSW	1	181769407	splice site	probably benign
R0125:Dnah14	UTSW	1	181752063	missense	probably damaging	0.99
R0579:Dnah14	UTSW	1	181744747	missense	possibly damaging	0.72
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0974:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R1609:Dnah14	UTSW	1	181750177	missense	probably damaging	0.97
R1860:Dnah14	UTSW	1	181763960	missense	probably damaging	1.00
R2050:Dnah14	UTSW	1	181752562	missense	probably damaging	1.00
R2974:Dnah14	UTSW	1	181755241	critical splice acceptor site	probably null
R4715:Dnah14	UTSW	1	181757223	missense	probably damaging	1.00
R5076:Dnah14	UTSW	1	181757234	missense	probably benign	0.01
R5424:Dnah14	UTSW	1	181763310	missense	possibly damaging	0.95
R5808:Dnah14	UTSW	1	181741159	missense	possibly damaging	0.72
R5997:Dnah14	UTSW	1	181770105	missense	probably benign	0.00
R6052:Dnah14	UTSW	1	181666487	missense	possibly damaging	0.50
R6061:Dnah14	UTSW	1	181709051	missense	probably damaging	1.00
R6089:Dnah14	UTSW	1	181750154	missense	probably damaging	1.00
R6092:Dnah14	UTSW	1	181621833	missense	probably benign	0.13
R6145:Dnah14	UTSW	1	181666417	missense	probably benign	0.00
R6163:Dnah14	UTSW	1	181666361	missense	probably benign	0.33
R6246:Dnah14	UTSW	1	181680888	missense	probably benign	0.00
R6302:Dnah14	UTSW	1	181601206	missense	possibly damaging	0.96
R6326:Dnah14	UTSW	1	181783556	missense	probably damaging	1.00
R6348:Dnah14	UTSW	1	181626720	missense	possibly damaging	0.83
R6367:Dnah14	UTSW	1	181755386	splice site	probably null
R6376:Dnah14	UTSW	1	181605894	missense	possibly damaging	0.79
R6389:Dnah14	UTSW	1	181651202	critical splice donor site	probably null
R6433:Dnah14	UTSW	1	181651657	missense	probably damaging	0.99
R6454:Dnah14	UTSW	1	181783705	missense	probably damaging	1.00
R6476:Dnah14	UTSW	1	181744768	missense	probably benign	0.26
R6523:Dnah14	UTSW	1	181643621	missense	probably benign	0.00
R6529:Dnah14	UTSW	1	181666469	missense	probably damaging	0.98
R6538:Dnah14	UTSW	1	181584985	missense	unknown
R6546:Dnah14	UTSW	1	181738987	missense	probably damaging	1.00
R6752:Dnah14	UTSW	1	181593452	missense	probably benign	0.07
R6762:Dnah14	UTSW	1	181757259	missense	probably damaging	1.00
R6786:Dnah14	UTSW	1	181641405	missense	probably benign	0.21
R6849:Dnah14	UTSW	1	181808945	missense	probably benign	0.00
R6877:Dnah14	UTSW	1	181628432	missense	possibly damaging	0.82
R6912:Dnah14	UTSW	1	181750183	missense	possibly damaging	0.83
R6919:Dnah14	UTSW	1	181585066	missense	probably benign	0.04
R6924:Dnah14	UTSW	1	181627952	missense	probably benign	0.04
R6957:Dnah14	UTSW	1	181785175	missense	possibly damaging	0.92
R6980:Dnah14	UTSW	1	181648230	missense	probably benign	0.00
R7018:Dnah14	UTSW	1	181626944	missense	possibly damaging	0.55
R7046:Dnah14	UTSW	1	181623003	missense	probably benign	0.01
R7058:Dnah14	UTSW	1	181698049	missense	probably benign	0.00
R7068:Dnah14	UTSW	1	181769790	missense	probably benign	0.35
R7115:Dnah14	UTSW	1	181720145	missense	probably damaging	1.00
R7130:Dnah14	UTSW	1	181745958	nonsense	probably null
R7165:Dnah14	UTSW	1	181704535	missense	probably benign	0.00
R7169:Dnah14	UTSW	1	181702365	missense	probably benign	0.00
R7184:Dnah14	UTSW	1	181704529	nonsense	probably null
R7232:Dnah14	UTSW	1	181757363	missense	probably damaging	1.00
R7260:Dnah14	UTSW	1	181706744	missense	probably damaging	0.99
R7276:Dnah14	UTSW	1	181685807	missense	probably benign	0.41
R7290:Dnah14	UTSW	1	181628174	missense	probably benign	0.20
R7314:Dnah14	UTSW	1	181785254	splice site	probably null
R7326:Dnah14	UTSW	1	181598403	missense	probably benign	0.02
R7336:Dnah14	UTSW	1	181797734	missense	probably damaging	0.96
R7363:Dnah14	UTSW	1	181690524	splice site	probably null
R7371:Dnah14	UTSW	1	181626885	missense	probably benign	0.05
R7376:Dnah14	UTSW	1	181763402	missense	probably benign	0.03
R7418:Dnah14	UTSW	1	181616742	missense	possibly damaging	0.92
R7473:Dnah14	UTSW	1	181752139	missense	probably damaging	0.99
R7514:Dnah14	UTSW	1	181628067	missense	probably damaging	0.96
R7555:Dnah14	UTSW	1	181770054	missense	probably benign	0.26
R7641:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7663:Dnah14	UTSW	1	181752155	splice site	probably null
R7674:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7680:Dnah14	UTSW	1	181685800	missense	probably benign	0.15
R7709:Dnah14	UTSW	1	181702484	critical splice donor site	probably null
R7842:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
R7861:Dnah14	UTSW	1	181616759	missense	probably damaging	1.00
R7988:Dnah14	UTSW	1	181783574	missense	probably damaging	0.97
R8016:Dnah14	UTSW	1	181648311	missense	probably benign	0.05
R8042:Dnah14	UTSW	1	181643631	critical splice donor site	probably null
R8071:Dnah14	UTSW	1	181615894	missense	possibly damaging	0.84
R8086:Dnah14	UTSW	1	181766232	missense	probably damaging	1.00
R8095:Dnah14	UTSW	1	181806032	nonsense	probably null
R8139:Dnah14	UTSW	1	181755288	missense	probably damaging	1.00
R8176:Dnah14	UTSW	1	181657033	missense	probably damaging	0.96
R8193:Dnah14	UTSW	1	181688205	missense	probably damaging	1.00
R8197:Dnah14	UTSW	1	181690101	missense	possibly damaging	0.94
R8209:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8226:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8251:Dnah14	UTSW	1	181664865	missense	probably damaging	1.00
R8264:Dnah14	UTSW	1	181744792	missense	probably damaging	0.99
R8284:Dnah14	UTSW	1	181773811	missense	probably benign	0.03
R8289:Dnah14	UTSW	1	181716215	nonsense	probably null
R8323:Dnah14	UTSW	1	181704544	missense	probably benign	0.01
R8442:Dnah14	UTSW	1	181741284	missense	probably damaging	0.97
R8458:Dnah14	UTSW	1	181806012	missense
R8507:Dnah14	UTSW	1	181641414	missense	probably benign	0.02
R8509:Dnah14	UTSW	1	181814655	missense
R8520:Dnah14	UTSW	1	181653638	missense	probably damaging	1.00
R8530:Dnah14	UTSW	1	181664946	missense	probably damaging	1.00
R8703:Dnah14	UTSW	1	181666011	nonsense	probably null
R8710:Dnah14	UTSW	1	181690311	missense	probably benign	0.04
R8752:Dnah14	UTSW	1	181628016	missense	probably benign	0.00
R8792:Dnah14	UTSW	1	181814624	missense
R8797:Dnah14	UTSW	1	181637847	missense	probably benign	0.19
R8821:Dnah14	UTSW	1	181792004	nonsense	probably null
R8834:Dnah14	UTSW	1	181616750	missense	possibly damaging	0.83
R8913:Dnah14	UTSW	1	181725498	missense	probably benign	0.01
R8925:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8927:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8934:Dnah14	UTSW	1	181622723	missense	possibly damaging	0.84
R9090:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9169:Dnah14	UTSW	1	181605816	missense	probably benign	0.06
R9199:Dnah14	UTSW	1	181651001	missense	possibly damaging	0.50
R9212:Dnah14	UTSW	1	181801287	missense	possibly damaging	0.95
R9213:Dnah14	UTSW	1	181616640	critical splice donor site	probably null
R9271:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9282:Dnah14	UTSW	1	181814512	missense
R9350:Dnah14	UTSW	1	181734804	missense	possibly damaging	0.79
R9358:Dnah14	UTSW	1	181709033	missense	probably benign	0.01
R9436:Dnah14	UTSW	1	181680783	missense	probably damaging	1.00
R9484:Dnah14	UTSW	1	181690208	missense	probably benign	0.45
R9484:Dnah14	UTSW	1	181797746	missense	probably benign	0.01
R9486:Dnah14	UTSW	1	181680929	missense	possibly damaging	0.68
R9546:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9547:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9578:Dnah14	UTSW	1	181674442	missense	probably benign	0.16
R9654:Dnah14	UTSW	1	181766339	missense	probably benign	0.01
R9681:Dnah14	UTSW	1	181734849	missense	possibly damaging	0.91
R9683:Dnah14	UTSW	1	181598944	missense	probably benign	0.01
R9687:Dnah14	UTSW	1	181598413	missense	probably benign	0.01
R9718:Dnah14	UTSW	1	181622979	missense	probably benign	0.08
R9751:Dnah14	UTSW	1	181792045	missense	probably damaging	1.00
R9757:Dnah14	UTSW	1	181685784	missense	probably benign	0.03
RF007:Dnah14	UTSW	1	181685809	missense	probably benign	0.00
RF012:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
Z1176:Dnah14	UTSW	1	181757351	missense	possibly damaging	0.83
Z1177:Dnah14	UTSW	1	181690320	missense	probably benign	0.03
Z1177:Dnah14	UTSW	1	181763334	missense	probably damaging	1.00
Z1177:Dnah14	UTSW	1	181766304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTGCTCCAAGGCAGAGAG -3'
(R):5'- TCATGACAGTCTTGAGAAGCAGG -3'

Sequencing Primer
(F):5'- CTCCAAGGCAGAGAGGAGATACTAAC -3'
(R):5'- ACAGTCTTGAGAAGCAGGTTTCATG -3'

Posted On

2018-04-02