Incidental Mutation 'R6306:Alpk1'
ID 509641
Institutional Source Beutler Lab
Gene Symbol Alpk1
Ensembl Gene ENSMUSG00000028028
Gene Name alpha-kinase 1
Synonyms 8430410J10Rik
MMRRC Submission 044468-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6306 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 127463959-127574176 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127479965 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 188 (D188G)
Ref Sequence ENSEMBL: ENSMUSP00000143223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029662
AA Change: D188G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: D188G

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159720
AA Change: D8G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160586
Predicted Effect probably damaging
Transcript: ENSMUST00000198955
AA Change: D188G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: D188G

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 G A 9: 90,060,331 (GRCm39) probably null Het
Adora2a T A 10: 75,169,238 (GRCm39) V234E probably damaging Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Ankrd17 A G 5: 90,392,013 (GRCm39) F1886L probably benign Het
Anks1 T G 17: 28,269,613 (GRCm39) L769R probably damaging Het
Apol10a A G 15: 77,373,161 (GRCm39) I266V probably benign Het
Arhgef28 T C 13: 98,121,896 (GRCm39) Y556C probably damaging Het
Brd8 T A 18: 34,744,304 (GRCm39) T175S probably damaging Het
Camsap2 C T 1: 136,208,937 (GRCm39) V852I probably benign Het
Cd55b G T 1: 130,341,803 (GRCm39) P278Q probably damaging Het
Cep290 T A 10: 100,367,028 (GRCm39) S1126R possibly damaging Het
Cfh C T 1: 140,030,155 (GRCm39) C906Y probably damaging Het
Chst13 C A 6: 90,286,260 (GRCm39) R234L probably damaging Het
Clcn7 T C 17: 25,376,502 (GRCm39) F611L probably benign Het
Cntnap1 A G 11: 101,075,441 (GRCm39) D873G probably damaging Het
Cntnap5b T C 1: 100,091,871 (GRCm39) I518T probably damaging Het
Col28a1 T C 6: 8,014,969 (GRCm39) E812G probably damaging Het
Cpa1 T C 6: 30,640,953 (GRCm39) I148T probably damaging Het
Cyp11a1 A G 9: 57,932,383 (GRCm39) N232S probably benign Het
Dhrs13 A G 11: 77,923,519 (GRCm39) D79G probably damaging Het
Disp1 T C 1: 182,868,712 (GRCm39) E1236G possibly damaging Het
Dnah1 A C 14: 31,026,544 (GRCm39) L778R probably damaging Het
Dnah14 CTGTG CTG 1: 181,412,589 (GRCm39) probably null Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dock9 A T 14: 121,799,492 (GRCm39) I1729N probably damaging Het
Dysf T C 6: 84,114,248 (GRCm39) V1192A possibly damaging Het
Enpp2 A G 15: 54,762,742 (GRCm39) S169P probably damaging Het
Fam114a2 T G 11: 57,404,972 (GRCm39) R43S probably damaging Het
Fam13a T C 6: 58,917,239 (GRCm39) T546A probably benign Het
Fos A T 12: 85,522,460 (GRCm39) D163V probably damaging Het
Fras1 T C 5: 96,912,805 (GRCm39) Y3370H probably damaging Het
Fshr T C 17: 89,507,961 (GRCm39) N27S probably null Het
Galnt6 A G 15: 100,591,305 (GRCm39) S600P possibly damaging Het
Gars1 T A 6: 55,032,809 (GRCm39) N260K probably damaging Het
Gpr158 C G 2: 21,820,422 (GRCm39) P640A possibly damaging Het
Grep1 T C 17: 23,925,124 (GRCm39) N495S possibly damaging Het
Grik3 A G 4: 125,526,205 (GRCm39) D146G probably benign Het
Hdac4 T C 1: 91,923,896 (GRCm39) T205A probably benign Het
Kcnq3 T C 15: 65,876,643 (GRCm39) D500G probably benign Het
Kmt5c A G 7: 4,749,480 (GRCm39) K333E probably benign Het
Krt81 A G 15: 101,357,404 (GRCm39) S443P probably benign Het
M6pr T C 6: 122,292,121 (GRCm39) probably null Het
Mccc2 T A 13: 100,130,085 (GRCm39) I91L probably benign Het
Nip7 A G 8: 107,785,055 (GRCm39) D110G probably damaging Het
Nol8 T A 13: 49,829,829 (GRCm39) F1093I probably damaging Het
Nrxn1 T C 17: 90,872,874 (GRCm39) T1027A possibly damaging Het
Ofcc1 T A 13: 40,302,052 (GRCm39) M495L probably benign Het
Or13p10 A T 4: 118,523,490 (GRCm39) M259L probably benign Het
Or7e178 A G 9: 20,225,742 (GRCm39) M158T probably benign Het
Pafah1b2 A T 9: 45,886,425 (GRCm39) V81D probably damaging Het
Pcdhga4 A T 18: 37,818,966 (GRCm39) S172C probably damaging Het
Pds5a A G 5: 65,813,639 (GRCm39) V282A probably damaging Het
Plat A G 8: 23,262,282 (GRCm39) D102G possibly damaging Het
Plce1 C A 19: 38,757,909 (GRCm39) Q1961K probably damaging Het
Plppr3 T A 10: 79,697,566 (GRCm39) K444* probably null Het
Plscr3 A G 11: 69,738,472 (GRCm39) probably null Het
Prtg A T 9: 72,813,468 (GRCm39) T943S probably benign Het
Racgap1 A G 15: 99,521,834 (GRCm39) F519L probably benign Het
Rbms2 A T 10: 127,987,050 (GRCm39) probably null Het
Rfx7 A G 9: 72,524,237 (GRCm39) T476A possibly damaging Het
Rnf150 T A 8: 83,810,131 (GRCm39) L421Q possibly damaging Het
Sema3b A G 9: 107,478,119 (GRCm39) L422P possibly damaging Het
Shank2 G A 7: 143,963,417 (GRCm39) A921T probably benign Het
Skint3 A T 4: 112,113,072 (GRCm39) E227D probably damaging Het
Slc25a19 G A 11: 115,508,386 (GRCm39) R201C possibly damaging Het
Slc38a10 G T 11: 120,038,645 (GRCm39) A40D probably damaging Het
Slc5a4b T C 10: 75,917,185 (GRCm39) T284A probably benign Het
Smc1b A T 15: 85,011,824 (GRCm39) F154I probably benign Het
Spry2 A T 14: 106,130,418 (GRCm39) M256K possibly damaging Het
Stkld1 C T 2: 26,833,899 (GRCm39) P129S probably damaging Het
Syce2 T C 8: 85,599,371 (GRCm39) L13S possibly damaging Het
Tbc1d15 C A 10: 115,069,148 (GRCm39) V74L possibly damaging Het
Tecpr2 T A 12: 110,911,185 (GRCm39) V1074D probably damaging Het
Tex36 G A 7: 133,197,054 (GRCm39) T21I probably benign Het
Ttn T G 2: 76,554,454 (GRCm39) D30787A probably damaging Het
Ttn T A 2: 76,622,264 (GRCm39) Q13710L probably benign Het
Usp34 T C 11: 23,362,260 (GRCm39) F1569L possibly damaging Het
Vat1l C T 8: 115,098,391 (GRCm39) A387V probably damaging Het
Vil1 G A 1: 74,460,470 (GRCm39) G209D possibly damaging Het
Vmn1r113 G T 7: 20,521,792 (GRCm39) D195Y probably damaging Het
Vmn2r69 A C 7: 85,064,799 (GRCm39) I29R probably benign Het
Vti1b G A 12: 79,207,323 (GRCm39) Q76* probably null Het
Zfp423 C A 8: 88,508,662 (GRCm39) V540F possibly damaging Het
Zfp644 T C 5: 106,785,990 (GRCm39) N186D probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp787 G A 7: 6,135,360 (GRCm39) A297V probably damaging Het
Zfp827 G T 8: 79,787,324 (GRCm39) Q163H probably damaging Het
Zfp955b T A 17: 33,522,160 (GRCm39) V543E probably benign Het
Other mutations in Alpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Alpk1 APN 3 127,474,692 (GRCm39) missense probably damaging 1.00
IGL00722:Alpk1 APN 3 127,473,862 (GRCm39) missense probably benign 0.00
IGL01066:Alpk1 APN 3 127,473,874 (GRCm39) missense probably benign 0.22
IGL01351:Alpk1 APN 3 127,466,011 (GRCm39) missense probably damaging 0.97
IGL01412:Alpk1 APN 3 127,473,621 (GRCm39) missense possibly damaging 0.60
IGL01469:Alpk1 APN 3 127,471,401 (GRCm39) splice site probably null
IGL01585:Alpk1 APN 3 127,473,462 (GRCm39) missense probably benign 0.01
IGL02308:Alpk1 APN 3 127,522,931 (GRCm39) missense probably damaging 0.99
IGL02325:Alpk1 APN 3 127,473,552 (GRCm39) missense probably benign 0.43
IGL02458:Alpk1 APN 3 127,474,968 (GRCm39) critical splice donor site probably null
IGL02553:Alpk1 APN 3 127,466,970 (GRCm39) missense probably damaging 1.00
IGL02717:Alpk1 APN 3 127,474,749 (GRCm39) missense possibly damaging 0.76
IGL02729:Alpk1 APN 3 127,474,721 (GRCm39) missense possibly damaging 0.87
IGL02832:Alpk1 APN 3 127,473,592 (GRCm39) missense possibly damaging 0.63
IGL02892:Alpk1 APN 3 127,473,771 (GRCm39) missense possibly damaging 0.92
IGL03178:Alpk1 APN 3 127,473,870 (GRCm39) nonsense probably null
R0427:Alpk1 UTSW 3 127,464,720 (GRCm39) missense probably damaging 1.00
R0981:Alpk1 UTSW 3 127,473,051 (GRCm39) missense possibly damaging 0.62
R1174:Alpk1 UTSW 3 127,474,459 (GRCm39) missense probably damaging 0.99
R1793:Alpk1 UTSW 3 127,471,447 (GRCm39) missense probably damaging 1.00
R1859:Alpk1 UTSW 3 127,474,749 (GRCm39) missense possibly damaging 0.76
R2173:Alpk1 UTSW 3 127,477,239 (GRCm39) missense probably damaging 1.00
R2235:Alpk1 UTSW 3 127,474,569 (GRCm39) missense probably benign 0.01
R2373:Alpk1 UTSW 3 127,473,457 (GRCm39) missense probably benign 0.00
R3803:Alpk1 UTSW 3 127,473,486 (GRCm39) missense possibly damaging 0.93
R3927:Alpk1 UTSW 3 127,471,365 (GRCm39) missense probably damaging 1.00
R4356:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4357:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4358:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4379:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4381:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4470:Alpk1 UTSW 3 127,473,175 (GRCm39) missense probably damaging 1.00
R4471:Alpk1 UTSW 3 127,473,175 (GRCm39) missense probably damaging 1.00
R4473:Alpk1 UTSW 3 127,473,667 (GRCm39) missense probably damaging 0.97
R4474:Alpk1 UTSW 3 127,473,667 (GRCm39) missense probably damaging 0.97
R4476:Alpk1 UTSW 3 127,473,667 (GRCm39) missense probably damaging 0.97
R4512:Alpk1 UTSW 3 127,478,120 (GRCm39) intron probably benign
R4594:Alpk1 UTSW 3 127,477,203 (GRCm39) missense probably damaging 1.00
R4678:Alpk1 UTSW 3 127,473,507 (GRCm39) missense probably damaging 0.99
R4707:Alpk1 UTSW 3 127,481,241 (GRCm39) missense possibly damaging 0.50
R4784:Alpk1 UTSW 3 127,481,241 (GRCm39) missense possibly damaging 0.50
R4785:Alpk1 UTSW 3 127,481,241 (GRCm39) missense possibly damaging 0.50
R4820:Alpk1 UTSW 3 127,464,708 (GRCm39) missense probably benign 0.06
R4887:Alpk1 UTSW 3 127,467,124 (GRCm39) missense probably damaging 1.00
R5088:Alpk1 UTSW 3 127,478,969 (GRCm39) splice site probably benign
R5169:Alpk1 UTSW 3 127,464,750 (GRCm39) missense probably damaging 1.00
R5280:Alpk1 UTSW 3 127,474,813 (GRCm39) missense probably benign 0.00
R5351:Alpk1 UTSW 3 127,522,941 (GRCm39) missense probably damaging 0.96
R5478:Alpk1 UTSW 3 127,471,368 (GRCm39) missense probably damaging 1.00
R5627:Alpk1 UTSW 3 127,474,296 (GRCm39) missense probably damaging 0.99
R5781:Alpk1 UTSW 3 127,473,684 (GRCm39) missense possibly damaging 0.92
R5842:Alpk1 UTSW 3 127,474,618 (GRCm39) missense probably damaging 1.00
R5847:Alpk1 UTSW 3 127,473,723 (GRCm39) missense probably benign 0.06
R5940:Alpk1 UTSW 3 127,464,595 (GRCm39) missense probably benign
R6187:Alpk1 UTSW 3 127,466,991 (GRCm39) missense probably damaging 1.00
R6414:Alpk1 UTSW 3 127,473,858 (GRCm39) missense probably benign
R6701:Alpk1 UTSW 3 127,522,985 (GRCm39) missense probably damaging 1.00
R6735:Alpk1 UTSW 3 127,518,098 (GRCm39) missense probably damaging 1.00
R6850:Alpk1 UTSW 3 127,523,012 (GRCm39) missense possibly damaging 0.87
R7173:Alpk1 UTSW 3 127,478,024 (GRCm39) nonsense probably null
R7258:Alpk1 UTSW 3 127,518,115 (GRCm39) missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127,489,382 (GRCm39) missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127,466,143 (GRCm39) missense probably damaging 1.00
R7498:Alpk1 UTSW 3 127,473,427 (GRCm39) missense probably benign 0.22
R7635:Alpk1 UTSW 3 127,489,310 (GRCm39) missense probably benign 0.01
R7660:Alpk1 UTSW 3 127,474,616 (GRCm39) missense probably damaging 1.00
R7682:Alpk1 UTSW 3 127,466,195 (GRCm39) missense possibly damaging 0.94
R7732:Alpk1 UTSW 3 127,478,041 (GRCm39) missense
R7827:Alpk1 UTSW 3 127,473,700 (GRCm39) missense probably benign 0.00
R8029:Alpk1 UTSW 3 127,522,934 (GRCm39) missense possibly damaging 0.95
R8383:Alpk1 UTSW 3 127,518,085 (GRCm39) missense probably benign 0.41
R8478:Alpk1 UTSW 3 127,522,961 (GRCm39) missense probably damaging 1.00
R8765:Alpk1 UTSW 3 127,466,118 (GRCm39) missense probably damaging 1.00
R8816:Alpk1 UTSW 3 127,478,024 (GRCm39) nonsense probably null
R8907:Alpk1 UTSW 3 127,474,642 (GRCm39) nonsense probably null
R8972:Alpk1 UTSW 3 127,473,232 (GRCm39) missense probably damaging 1.00
R8974:Alpk1 UTSW 3 127,473,580 (GRCm39) missense probably benign 0.03
R9039:Alpk1 UTSW 3 127,473,192 (GRCm39) missense probably damaging 1.00
R9202:Alpk1 UTSW 3 127,479,938 (GRCm39) missense
R9394:Alpk1 UTSW 3 127,466,187 (GRCm39) missense probably damaging 1.00
R9421:Alpk1 UTSW 3 127,467,069 (GRCm39) missense probably damaging 1.00
R9436:Alpk1 UTSW 3 127,478,924 (GRCm39) missense
R9785:Alpk1 UTSW 3 127,473,594 (GRCm39) missense probably benign 0.22
Z1176:Alpk1 UTSW 3 127,467,087 (GRCm39) missense probably damaging 1.00
Z1177:Alpk1 UTSW 3 127,478,956 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CAGCTCCAGGTATCTAATGTCATTTTC -3'
(R):5'- CATGGAAGCCATCTCCTGTG -3'

Sequencing Primer
(F):5'- CTTCTCAAGAGGACTACTATGGG -3'
(R):5'- CTCCTGTGGAGTCATGGGGAATAG -3'
Posted On 2018-04-02