Incidental Mutation 'R6306:Cyp11a1'
ID509671
Institutional Source Beutler Lab
Gene Symbol Cyp11a1
Ensembl Gene ENSMUSG00000032323
Gene Namecytochrome P450, family 11, subfamily a, polypeptide 1
SynonymsCyp11a, cholesterol side chain cleavage, Scc, cscc, D9Ertd411e, P450scc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6306 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location58006411-58027023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58025100 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 232 (N232S)
Ref Sequence ENSEMBL: ENSMUSP00000140777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034874] [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000188116] [ENSMUST00000188539] [ENSMUST00000215944]
Predicted Effect probably benign
Transcript: ENSMUST00000034874
AA Change: N334S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034874
Gene: ENSMUSG00000032323
AA Change: N334S

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Pfam:p450 49 507 1.8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042205
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098682
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119665
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144887
Predicted Effect probably benign
Transcript: ENSMUST00000188116
SMART Domains Protein: ENSMUSP00000140545
Gene: ENSMUSG00000032323

DomainStartEndE-ValueType
Pfam:p450 32 115 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188539
AA Change: N232S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140777
Gene: ENSMUSG00000032323
AA Change: N232S

DomainStartEndE-ValueType
Pfam:p450 23 279 2.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188944
Predicted Effect probably benign
Transcript: ENSMUST00000215944
Meta Mutation Damage Score 0.1092 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are exhibit a steroid deficiency and die within days of birth showing signs of dehydration. Males are feminized with female external genitalia and underdeveloped gonads. Mice homozgyous for another knock-out allele exhibit abnormal adrenal development and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T C 17: 23,706,150 N495S possibly damaging Het
Adamts7 G A 9: 90,178,278 probably null Het
Adora2a T A 10: 75,333,404 V234E probably damaging Het
Alpk1 T C 3: 127,686,316 D188G probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ankrd17 A G 5: 90,244,154 F1886L probably benign Het
Anks1 T G 17: 28,050,639 L769R probably damaging Het
Apol10a A G 15: 77,488,961 I266V probably benign Het
Arhgef28 T C 13: 97,985,388 Y556C probably damaging Het
Brd8 T A 18: 34,611,251 T175S probably damaging Het
Camsap2 C T 1: 136,281,199 V852I probably benign Het
Cd55b G T 1: 130,414,066 P278Q probably damaging Het
Cep290 T A 10: 100,531,166 S1126R possibly damaging Het
Cfh C T 1: 140,102,417 C906Y probably damaging Het
Chst13 C A 6: 90,309,278 R234L probably damaging Het
Clcn7 T C 17: 25,157,528 F611L probably benign Het
Cntnap1 A G 11: 101,184,615 D873G probably damaging Het
Cntnap5b T C 1: 100,164,146 I518T probably damaging Het
Col28a1 T C 6: 8,014,969 E812G probably damaging Het
Cpa1 T C 6: 30,640,954 I148T probably damaging Het
Dhrs13 A G 11: 78,032,693 D79G probably damaging Het
Disp1 T C 1: 183,087,148 E1236G possibly damaging Het
Dnah1 A C 14: 31,304,587 L778R probably damaging Het
Dnah14 CTGTG CTG 1: 181,585,024 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock9 A T 14: 121,562,080 I1729N probably damaging Het
Dysf T C 6: 84,137,266 V1192A possibly damaging Het
Enpp2 A G 15: 54,899,346 S169P probably damaging Het
Fam114a2 T G 11: 57,514,146 R43S probably damaging Het
Fam13a T C 6: 58,940,254 T546A probably benign Het
Fos A T 12: 85,475,686 D163V probably damaging Het
Fras1 T C 5: 96,764,946 Y3370H probably damaging Het
Fshr T C 17: 89,200,533 N27S probably null Het
Galnt6 A G 15: 100,693,424 S600P possibly damaging Het
Gars T A 6: 55,055,824 N260K probably damaging Het
Gpr158 C G 2: 21,815,611 P640A possibly damaging Het
Grik3 A G 4: 125,632,412 D146G probably benign Het
Hdac4 T C 1: 91,996,174 T205A probably benign Het
Kcnq3 T C 15: 66,004,794 D500G probably benign Het
Kmt5c A G 7: 4,746,481 K333E probably benign Het
Krt81 A G 15: 101,459,523 S443P probably benign Het
M6pr T C 6: 122,315,162 probably null Het
Mccc2 T A 13: 99,993,577 I91L probably benign Het
Nip7 A G 8: 107,058,423 D110G probably damaging Het
Nol8 T A 13: 49,676,353 F1093I probably damaging Het
Nrxn1 T C 17: 90,565,446 T1027A possibly damaging Het
Ofcc1 T A 13: 40,148,576 M495L probably benign Het
Olfr18 A G 9: 20,314,446 M158T probably benign Het
Olfr62 A T 4: 118,666,293 M259L probably benign Het
Pafah1b2 A T 9: 45,975,127 V81D probably damaging Het
Pcdhga4 A T 18: 37,685,913 S172C probably damaging Het
Pds5a A G 5: 65,656,296 V282A probably damaging Het
Plat A G 8: 22,772,266 D102G possibly damaging Het
Plce1 C A 19: 38,769,465 Q1961K probably damaging Het
Plppr3 T A 10: 79,861,732 K444* probably null Het
Plscr3 A G 11: 69,847,646 probably null Het
Prtg A T 9: 72,906,186 T943S probably benign Het
Racgap1 A G 15: 99,623,953 F519L probably benign Het
Rbms2 A T 10: 128,151,181 probably null Het
Rfx7 A G 9: 72,616,955 T476A possibly damaging Het
Rnf150 T A 8: 83,083,502 L421Q possibly damaging Het
Sema3b A G 9: 107,600,920 L422P possibly damaging Het
Shank2 G A 7: 144,409,680 A921T probably benign Het
Skint3 A T 4: 112,255,875 E227D probably damaging Het
Slc25a19 G A 11: 115,617,560 R201C possibly damaging Het
Slc38a10 G T 11: 120,147,819 A40D probably damaging Het
Slc5a4b T C 10: 76,081,351 T284A probably benign Het
Smc1b A T 15: 85,127,623 F154I probably benign Het
Spry2 A T 14: 105,892,984 M256K possibly damaging Het
Stkld1 C T 2: 26,943,887 P129S probably damaging Het
Syce2 T C 8: 84,872,742 L13S possibly damaging Het
Tbc1d15 C A 10: 115,233,243 V74L possibly damaging Het
Tecpr2 T A 12: 110,944,751 V1074D probably damaging Het
Tex36 G A 7: 133,595,325 T21I probably benign Het
Ttn T G 2: 76,724,110 D30787A probably damaging Het
Ttn T A 2: 76,791,920 Q13710L probably benign Het
Usp34 T C 11: 23,412,260 F1569L possibly damaging Het
Vat1l C T 8: 114,371,651 A387V probably damaging Het
Vil1 G A 1: 74,421,311 G209D possibly damaging Het
Vmn1r113 G T 7: 20,787,867 D195Y probably damaging Het
Vmn2r69 A C 7: 85,415,591 I29R probably benign Het
Vti1b G A 12: 79,160,549 Q76* probably null Het
Zfp423 C A 8: 87,782,034 V540F possibly damaging Het
Zfp644 T C 5: 106,638,124 N186D probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp787 G A 7: 6,132,361 A297V probably damaging Het
Zfp827 G T 8: 79,060,695 Q163H probably damaging Het
Zfp955b T A 17: 33,303,186 V543E probably benign Het
Other mutations in Cyp11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Cyp11a1 APN 9 58019313 missense probably damaging 1.00
IGL01122:Cyp11a1 APN 9 58016306 missense probably damaging 1.00
IGL01993:Cyp11a1 APN 9 58020823 missense probably damaging 1.00
PIT4431001:Cyp11a1 UTSW 9 58016272 critical splice acceptor site probably null
R0347:Cyp11a1 UTSW 9 58016260 unclassified probably benign
R1446:Cyp11a1 UTSW 9 58015277 missense possibly damaging 0.95
R1774:Cyp11a1 UTSW 9 58018360 missense probably benign 0.05
R1918:Cyp11a1 UTSW 9 58026757 missense probably damaging 1.00
R2935:Cyp11a1 UTSW 9 58016390 missense probably damaging 1.00
R3724:Cyp11a1 UTSW 9 58019322 missense probably benign 0.00
R4866:Cyp11a1 UTSW 9 58026097 missense probably damaging 1.00
R5301:Cyp11a1 UTSW 9 58019261 intron probably benign
R5718:Cyp11a1 UTSW 9 58018225 missense probably benign 0.00
R5787:Cyp11a1 UTSW 9 58015267 missense probably benign 0.03
R5988:Cyp11a1 UTSW 9 58020834 missense probably benign 0.01
R6044:Cyp11a1 UTSW 9 58026704 missense probably damaging 1.00
R6286:Cyp11a1 UTSW 9 58017418 intron probably benign
R6325:Cyp11a1 UTSW 9 58025568 missense probably benign
R6826:Cyp11a1 UTSW 9 58025087 missense probably damaging 0.97
R6931:Cyp11a1 UTSW 9 58025120 missense possibly damaging 0.77
R6960:Cyp11a1 UTSW 9 58018376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGGAATATCCCTTCCTAGGC -3'
(R):5'- ATTAGCCCATCCTTGGAACC -3'

Sequencing Primer
(F):5'- CATACTCAACATATATGGTGCCGGG -3'
(R):5'- ATCCTTGGAACCCTCTCCAGG -3'
Posted On2018-04-02